CLON GABI_089E07[Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] 
TYPE GABI-Kat FST
CHRO chr1
EVAL e-127
COOR W/78969-79233
NOTE - -

HITS AT1G08765.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G08765.1 transcript_region ID=AT1G08765.1; Parent=AT1G08765; computational_description=novel transcribed region; Name=AT1G08765.1; locus_type=novel_transcribed_region LOCN Exon COOR W/77537-80345 HITS AT1G08765.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G08765.2 transcript_region ID=AT1G08765.2; Parent=AT1G08765; computational_description=novel transcribed region; Name=AT1G08765.2; locus_type=novel_transcribed_region LOCN Exon COOR W/77727-79340 HITS AT1TE00225[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE00225 transposable_element ID=AT1TE00225; Name=AT1TE00225; Alias=HELITRONY1D LOCN 300-UTR5 COOR C/78288-78785 HITS AT1G01183.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01183.1 miRNA_primary_transcript ID=AT1G01183.1; Parent=AT1G01183; Alias=p_MI0000199; Name=ath-MIR165a; symbol=MIR165A; curator_summary=Encodes a microRNA that targets several HD-ZIPIII family members including PHV%2C PHB%2C REV%2C ATHB-8%2C and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC; Note=microRNA ath-MIR165a precursor; full_name=microRNA165A; Dbxref=PMID:15200956, PMID:18794352, PMID:19054365, PMID:17549070, PMID:19704656, PMID:19879265, PMID:20410882, PMID:21483759, PMID:21558378, PMID:21610018, PMID:22476466, PMID:22589131, PMID:22951404, PMID:23292599, PMID:23645346, PMID:23918970, PMID:23935517, PMID:24296072, locus:1009023078, PMID:15200956, PMID:18794352, PMID:19054365, PMID:17549070, PMID:19704656, PMID:19879265, PMID:20410882, PMID:21483759, PMID:21558378, PMID:21610018, PMID:22476466, PMID:22589131, PMID:22951404, PMID:23292599, PMID:23645346, PMID:23918970, PMID:23935517, PMID:24296072, PMID:25406978, PMID:25711809, locus:1009023078; locus_type=mirna LOCN Exon COOR C/78927-79037 HITS ath-miR165a-3p[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL ath-miR165a-3p miRNA ID=ath-miR165a-3p; Alias=MIMAT0000187; Name=ath-miR165a-3p; Derives_from=AT1G01183.1; Note=microRNA ath-miR165a-3p; computational_description=mature miRNA accession:MIMAT0000187 LOCN 300-UTR5 COOR C/78932-78952 HITS ath-miR165a-5p[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL ath-miR165a-5p miRNA ID=ath-miR165a-5p; Alias=MIMAT0031879; Name=ath-miR165a-5p; Derives_from=AT1G01183.1; Note=microRNA ath-miR165a-5p; computational_description=mature miRNA accession:MIMAT0031879 LOCN 300-UTR3 COOR C/79010-79030 CLON GABI_089E07[Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST CHRO chr5 EVAL 1e-34 COOR W/7258886-7258959 NOTE - - HITS AT5G21960.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT5G21960.1 CDS ID=AT5G21960.1; Parent=AT5G21960; Name=AT5G21960.1; Note=Integrase-type DNA-binding superfamily protein; curator_summary=encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1%2C RAP2.9 and RAP2.10.; conf_class=1; computational_description=Integrase-type DNA-binding superfamily protein%3B FUNCTIONS IN: DNA binding%2C sequence-specific DNA binding transcription factor activity%3B INVOLVED IN: regulation of transcription%2C DNA-dependent%3B LOCATED IN: nucleus%3B CONTAINS InterPro DOMAIN/s: DNA-binding%2C integrase-type (InterPro:IPR016177)%2C Pathogenesis-related transcriptional factor/ERF%2C DNA-binding (InterPro:IPR001471)%3B BEST Arabidopsis thaliana protein match is: Integrase-type DNA-binding superfamily protein (TAIR:AT1G19210.1)%3B Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12%3B Bacteria - 1396%3B Metazoa - 17338%3B Fungi - 3422%3B Plants - 5037%3B Viruses - 0%3B Other Eukaryotes - 2996 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:18252252, locus:504956445; locus_type=protein_coding LOCN Exon COOR C/7258560-7259210