CODE AT1G01046.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01046.1 miRNA_primary_transcript ID=AT1G01046.1; Parent=AT1G01046; Alias=p_MI0005394; Name=ath-MIR838; symbol=MIR838A; curator_summary=Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUUCUUCUACUUCUUGCACA; Note=microRNA ath-MIR838 precursor; full_name=microRNA838A; Dbxref=locus:4515102484, locus:4515102484; locus_type=mirna COOR W/28500-28706 HITS GATCACTAAAGCATCTC [About MPSS mRNA] TYPE MPSS mRNA Target EVAL 100.00 LOCN 1000-Promotor COOR W/27659-27675 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 HITS ASRP200726 [About ASRP sRNA] TYPE ASRP sRNA contig EVAL 100.00 LOCN 1000-Promotor COOR W/27833-27854 HITS GATCCCATGGTGTCGTG [About MPSS mRNA] TYPE MPSS mRNA Target EVAL 100.00 LOCN 1000-Promotor COOR C/27871-27887 NOTE 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 0 0 HITS CATCCTTCGATGTTGTG [About MPSS sRNA] TYPE MPSS sRNA Contig EVAL 100.00 LOCN 1000-Promotor COOR W/28152-28168 NOTE 1, +0 4 0 0 0 HITS RAFL07-36-P21 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 98.54 LOCN Exon COOR W/28521-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31183 HITS ASRP159401 [About ASRP sRNA] TYPE ASRP sRNA contig EVAL 100.00 LOCN Exon COOR W/28533-28556 HITS ASRP186012 [About ASRP sRNA] TYPE ASRP sRNA contig EVAL 100.00 LOCN Exon COOR W/28634-28655 HITS BU636534 [GenBank] TYPE ESTs EVAL 0.0 LOCN 300-UTR3 COOR W/28909-29076,29158-29714 HITS ASRP87688 [About ASRP sRNA] TYPE ASRP sRNA contig EVAL 100.00 LOCN 300-UTR3 COOR C/28969-28989