CLON JN661701[GenBank] 
TYPE Community cDNA
CHRO chr1
EVAL 100.00
COOR W/23146-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31227

HITS AT1G03993.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G03993.1 antisense_lncRNA ID=AT1G03993.1; Parent=AT1G03993; Name=AT1G03993.1; description=Natural antisense transcript overlaps with AT1G01040; Note=Natural antisense transcript overlaps with AT1G01040; locus_type=antisense_long_noncoding_rna LOCN Exon COOR C/23312-24099 HITS AT1G01040.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01040.1 CDS ID=AT1G01040.1; Parent=AT1G01040; Name=AT1G01040.1; Note=dicer-like 1; curator_summary=Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state%2C others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.; conf_class=2; symbol=DCL1; Alias=ASU1, ABNORMAL SUSPENSOR 1, ATDCL1, DICER-LIKE 1, CAF, CARPEL FACTORY, EMB60, EMBRYO DEFECTIVE 60, EMB76, EMBRYO DEFECTIVE 76, SIN1, SHORT INTEGUMENTS 1, SUS1, SUSPENSOR 1; full_name=dicer-like 1; computational_description=dicer-like 1 (DCL1)%3B CONTAINS InterPro DOMAIN/s: Restriction endonuclease%2C type I%2C R subunit/Type III%2C Res subunit (InterPro:IPR006935)%2C Double-stranded RNA-binding (InterPro:IPR001159)%2C Argonaute/Dicer protein%2C PAZ (InterPro:IPR003100)%2C Ribonuclease III (InterPro:IPR000999)%2C Double-stranded RNA-binding-like (InterPro:IPR014720)%2C DEAD-like helicase%2C N-terminal (InterPro:IPR014001)%2C DNA/RNA helicase%2C C-terminal (InterPro:IPR001650)%2C Helicase%2C superfamily 1/2%2C ATP-binding domain (InterPro:IPR014021)%2C Dicer double-stranded RNA-binding fold (InterPro:IPR005034)%3B BEST Arabidopsis thaliana protein match is: dicer-like 3 (TAIR:AT3G43920.2)%3B Has 21958 Blast hits to 17420 proteins in 2982 species: Archae - 328%3B Bacteria - 11461%3B Metazoa - 3615%3B Fungi - 1668%3B Plants - 1373%3B Viruses - 45%3B Other Eukaryotes - 3468 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:10556049, PMID:8948599, PMID:8787738, PMID:7982564, PMID:12101121, PMID:12324593, PMID:12297633, PMID:12225663, PMID:12417148, PMID:12376646, PMID:12573220, PMID:12747833, PMID:12725739, PMID:12857820, PMID:14972688, PMID:15024409, PMID:15314213, PMID:15469823, PMID:15851028, PMID:16033795, PMID:16111943, PMID:16096641, PMID:16040244, PMID:16141062, PMID:16144699, PMID:15821876, PMID:16214897, PMID:16428603, PMID:16500993, PMID:16699516, PMID:16682354, PMID:16810317, PMID:16889646, PMID:17090584, PMID:17182867, PMID:17164336, PMID:17337628, PMID:17369351, PMID:17442570, PMID:17558406, PMID:17675322, PMID:18003861, PMID:18208512, PMID:18550839, PMID:18650403, PMID:18632581, PMID:18632569, PMID:18625233, PMID:18799732, PMID:18842626, PMID:18997003, PMID:19221817, PMID:17071740, PMID:18551175, PMID:19155326, PMID:19307293, PMID:19436261, PMID:19816405, PMID:20106953, PMID:20409179, PMID:20462493, PMID:20439431, PMID:20621980, PMID:20870966, PMID:19649244, PMID:19953107, PMID:21123653, PMID:21330492, PMID:21295131, PMID:21378120, PMID:21589905, PMID:21685453, PMID:22439910, PMID:22474216, PMID:22589469, PMID:22802657, PMID:22902697, PMID:22846193, PMID:23110057, PMID:23268445, PMID:23313986, PMID:23424246, PMID:23399598, PMID:23457227, PMID:23194006, PMID:23886622, PMID:23847640, PMID:23941160, PMID:23934148, PMID:23921632, PMID:24018204, PMID:24092744, PMID:24137006, PMID:24204292, PMID:24531234, PMID:24670663, PMID:24769482, PMID:24731939, PMID:24717238, PMID:24784759, PMID:25226037, PMID:25409478, PMID:25491479, PMID:25474114, PMID:25443390, PMID:23104109, locus:2200960; locus_type=protein_coding LOCN Exon COOR W/23519-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27533,27618-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31079 HITS AT1G01040.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01040.2 CDS ID=AT1G01040.2; Parent=AT1G01040; Name=AT1G01040.2; Note=dicer-like 1; curator_summary=Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state%2C others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.; conf_class=2; symbol=DCL1; Alias=ASU1, ABNORMAL SUSPENSOR 1, ATDCL1, DICER-LIKE 1, CAF, CARPEL FACTORY, EMB60, EMBRYO DEFECTIVE 60, EMB76, EMBRYO DEFECTIVE 76, SIN1, SHORT INTEGUMENTS 1, SUS1, SUSPENSOR 1; full_name=dicer-like 1; computational_description=dicer-like 1 (DCL1)%3B CONTAINS InterPro DOMAIN/s: Restriction endonuclease%2C type I%2C R subunit/Type III%2C Res subunit (InterPro:IPR006935)%2C Double-stranded RNA-binding (InterPro:IPR001159)%2C Argonaute/Dicer protein%2C PAZ (InterPro:IPR003100)%2C Ribonuclease III (InterPro:IPR000999)%2C Double-stranded RNA-binding-like (InterPro:IPR014720)%2C DEAD-like helicase%2C N-terminal (InterPro:IPR014001)%2C DNA/RNA helicase%2C C-terminal (InterPro:IPR001650)%2C Helicase%2C superfamily 1/2%2C ATP-binding domain (InterPro:IPR014021)%2C Dicer double-stranded RNA-binding fold (InterPro:IPR005034)%3B BEST Arabidopsis thaliana protein match is: dicer-like 3 (TAIR:AT3G43920.2)%3B Has 21958 Blast hits to 17420 proteins in 2982 species: Archae - 328%3B Bacteria - 11461%3B Metazoa - 3615%3B Fungi - 1668%3B Plants - 1373%3B Viruses - 45%3B Other Eukaryotes - 3468 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:10556049, PMID:8948599, PMID:8787738, PMID:7982564, PMID:12101121, PMID:12324593, PMID:12297633, PMID:12225663, PMID:12417148, PMID:12376646, PMID:12573220, PMID:12747833, PMID:12725739, PMID:12857820, PMID:14972688, PMID:15024409, PMID:15314213, PMID:15469823, PMID:15851028, PMID:16033795, PMID:16111943, PMID:16096641, PMID:16040244, PMID:16141062, PMID:16144699, PMID:15821876, PMID:16214897, PMID:16428603, PMID:16500993, PMID:16699516, PMID:16682354, PMID:16810317, PMID:16889646, PMID:17090584, PMID:17182867, PMID:17164336, PMID:17337628, PMID:17369351, PMID:17442570, PMID:17558406, PMID:17675322, PMID:18003861, PMID:18208512, PMID:18550839, PMID:18650403, PMID:18632581, PMID:18632569, PMID:18625233, PMID:18799732, PMID:18842626, PMID:18997003, PMID:19221817, PMID:17071740, PMID:18551175, PMID:19155326, PMID:19307293, PMID:19436261, PMID:19816405, PMID:20106953, PMID:20409179, PMID:20462493, PMID:20439431, PMID:20621980, PMID:20870966, PMID:19649244, PMID:19953107, PMID:21123653, PMID:21330492, PMID:21295131, PMID:21378120, PMID:21589905, PMID:21685453, PMID:22439910, PMID:22474216, PMID:22589469, PMID:22802657, PMID:22902697, PMID:22846193, PMID:23110057, PMID:23268445, PMID:23313986, PMID:23424246, PMID:23399598, PMID:23457227, PMID:23194006, PMID:23886622, PMID:23847640, PMID:23941160, PMID:23934148, PMID:23921632, PMID:24018204, PMID:24092744, PMID:24137006, PMID:24204292, PMID:24531234, PMID:24670663, PMID:24769482, PMID:24731939, PMID:24717238, PMID:24784759, PMID:25226037, PMID:25409478, PMID:25491479, PMID:25474114, PMID:25443390, PMID:23104109, locus:2200960; locus_type=protein_coding LOCN Exon COOR W/23519-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27536,27618-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31079 HITS AT1G01046.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01046.1 miRNA_primary_transcript ID=AT1G01046.1; Parent=AT1G01046; Alias=p_MI0005394; Name=ath-MIR838; symbol=MIR838A; curator_summary=Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUUCUUCUACUUCUUGCACA; Note=microRNA ath-MIR838 precursor; full_name=microRNA838A; Dbxref=locus:4515102484, locus:4515102484; locus_type=mirna LOCN Exon COOR W/28500-28706 HITS ath-miR838[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL ath-miR838 miRNA ID=ath-miR838; Alias=MIMAT0004260; Name=ath-miR838; Derives_from=AT1G01046.1; Note=microRNA ath-miR838; computational_description=mature miRNA accession:MIMAT0004260 LOCN Exon COOR W/28635-28655 HITS AT1G01050.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01050.1 CDS ID=AT1G01050.1; Parent=AT1G01050; Name=AT1G01050.1; Note=pyrophosphorylase 1; curator_summary=Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate.; conf_class=2; symbol=PPa1; Alias=AtPPa1, pyrophosphorylase 1; full_name=pyrophosphorylase 1; computational_description=pyrophosphorylase 1 (PPa1)%3B FUNCTIONS IN: inorganic diphosphatase activity%3B INVOLVED IN: phosphate metabolic process%2C metabolic process%3B LOCATED IN: nucleus%2C membrane%2C cytoplasm%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Inorganic pyrophosphatase (InterPro:IPR008162)%3B BEST Arabidopsis thaliana protein match is: pyrophosphorylase 3 (TAIR:AT2G46860.1)%3B Has 5987 Blast hits to 5987 proteins in 1845 species: Archae - 172%3B Bacteria - 4313%3B Metazoa - 247%3B Fungi - 261%3B Plants - 270%3B Viruses - 0%3B Other Eukaryotes - 724 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15135060, PMID:15610358, PMID:15703057, PMID:18775970, PMID:22566496, PMID:23438466, PMID:25663508, locus:2200965; locus_type=protein_coding LOCN 300-UTR3 COOR C/31382-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670 HITS AT1G01050.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01050.2 CDS ID=AT1G01050.2; Parent=AT1G01050; Name=AT1G01050.2; Note=pyrophosphorylase 1; symbol=PPa1; Alias=AtPPa1, pyrophosphorylase 1; full_name=pyrophosphorylase 1; Dbxref=PMID:15135060, PMID:15610358, PMID:15703057, PMID:18775970, PMID:22566496, PMID:23438466, PMID:25663508, locus:2200965; curator_summary=Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate.; computational_description=pyrophosphorylase 1 (PPa1)%3B FUNCTIONS IN: inorganic diphosphatase activity%3B INVOLVED IN: phosphate metabolic process%2C metabolic process%3B LOCATED IN: nucleus%2C membrane%2C cytoplasm%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Inorganic pyrophosphatase (InterPro:IPR008162)%3B BEST Arabidopsis thaliana protein match is: pyrophosphorylase 3 (TAIR:AT2G46860.1)%3B Has 5987 Blast hits to 5987 proteins in 1845 species: Archae - 172%3B Bacteria - 4313%3B Metazoa - 247%3B Fungi - 261%3B Plants - 270%3B Viruses - 0%3B Other Eukaryotes - 724 (source: NCBI BLink).; locus_type=protein_coding LOCN 300-UTR3 COOR C/31382-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670