AtTome: Genome Express Database ( Aug. 2, 2016 )


CLON JAtY67L08[About JAtY] 
TYPE JAtY TAC
CHRO chr1
EVAL 0.0
COOR C/38255-121639

HITS AT1G01070.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01070.1 CDS ID=AT1G01070.1; Parent=AT1G01070; Name=AT1G01070.1; Note=nodulin MtN21 /EamA-like transporter family protein; curator_summary=nodulin MtN21-like transporter family protein; conf_class=2; symbol=UMAMIT28; full_name=Usually multiple acids move in and out Transporters 28; computational_description=nodulin MtN21 /EamA-like transporter family protein%3B LOCATED IN: membrane%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 7 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6%2C transmembrane (InterPro:IPR000620)%3B BEST Arabidopsis thaliana protein match is: nodulin MtN21 /EamA-like transporter family protein (TAIR:AT1G11460.1)%3B Has 3211 Blast hits to 3199 proteins in 599 species: Archae - 23%3B Bacteria - 1686%3B Metazoa - 4%3B Fungi - 6%3B Plants - 1233%3B Viruses - 0%3B Other Eukaryotes - 259 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15703057, locus:2200990; locus_type=protein_coding LOCN Exon COOR C/38898-39054,39136-39287,39409-39814,40213-40329,40473-40535,40675-40877 HITS AT1G01070.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01070.2 CDS ID=AT1G01070.2; Parent=AT1G01070; Name=AT1G01070.2; Note=nodulin MtN21 /EamA-like transporter family protein; curator_summary=nodulin MtN21-like transporter family protein; conf_class=1; symbol=UMAMIT28; full_name=Usually multiple acids move in and out Transporters 28; computational_description=nodulin MtN21 /EamA-like transporter family protein%3B LOCATED IN: membrane%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 7 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6%2C transmembrane (InterPro:IPR000620)%3B BEST Arabidopsis thaliana protein match is: nodulin MtN21 /EamA-like transporter family protein (TAIR:AT1G11460.1)%3B Has 3211 Blast hits to 3199 proteins in 599 species: Archae - 23%3B Bacteria - 1686%3B Metazoa - 4%3B Fungi - 6%3B Plants - 1233%3B Viruses - 0%3B Other Eukaryotes - 259 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:15703057, locus:2200990; locus_type=protein_coding LOCN Exon COOR C/38898-39054,39136-39287,39409-39814,40213-40329,40473-40597 HITS AT1G04003.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G04003.1 lnc_RNA ID=AT1G04003.1; Parent=AT1G04003; Name=AT1G04003.1; locus_type=long_noncoding_rna LOCN Exon COOR C/43087-43295 HITS AT1G01080.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01080.1 CDS ID=AT1G01080.1; Parent=AT1G01080; Name=AT1G01080.1; Note=RNA-binding (RRM/RBD/RNP motifs) family protein; conf_class=2; computational_description=RNA-binding (RRM/RBD/RNP motifs) family protein%3B FUNCTIONS IN: RNA binding%2C nucleotide binding%2C nucleic acid binding%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: chloroplast stroma%2C nucleus%2C chloroplast%2C chloroplast envelope%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: RNA recognition motif%2C RNP-1 (InterPro:IPR000504)%2C Nucleotide-binding%2C alpha-beta plait (InterPro:IPR012677)%3B BEST Arabidopsis thaliana protein match is: RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G60000.1)%3B Has 509067 Blast hits to 499893 proteins in 22124 species: Archae - 10819%3B Bacteria - 303967%3B Metazoa - 99035%3B Fungi - 14863%3B Plants - 31737%3B Viruses - 35534%3B Other Eukaryotes - 13112 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:14576160, PMID:15703057, PMID:18650403, locus:2200975; locus_type=protein_coding LOCN Exon COOR C/45503-45559,45646-45954,46044-46145,46376-46789 HITS AT1G01080.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01080.2 CDS ID=AT1G01080.2; Parent=AT1G01080; Name=AT1G01080.2; Note=RNA-binding (RRM/RBD/RNP motifs) family protein; conf_class=2; computational_description=RNA-binding (RRM/RBD/RNP motifs) family protein%3B FUNCTIONS IN: RNA binding%2C nucleotide binding%2C nucleic acid binding%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: chloroplast stroma%2C nucleus%2C chloroplast%2C chloroplast envelope%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: RNA recognition motif%2C RNP-1 (InterPro:IPR000504)%2C Nucleotide-binding%2C alpha-beta plait (InterPro:IPR012677)%3B BEST Arabidopsis thaliana protein match is: RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G60000.1)%3B Has 509067 Blast hits to 499893 proteins in 22124 species: Archae - 10819%3B Bacteria - 303967%3B Metazoa - 99035%3B Fungi - 14863%3B Plants - 31737%3B Viruses - 35534%3B Other Eukaryotes - 13112 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:14576160, PMID:15703057, PMID:18650403, locus:2200975; locus_type=protein_coding LOCN Exon COOR C/45503-45559,45646-45954,46044-46145,46373-46789 HITS AT1G01080.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01080.3 CDS ID=AT1G01080.3; Parent=AT1G01080; Name=AT1G01080.3; Note=RNA-binding (RRM/RBD/RNP motifs) family protein; computational_description=RNA-binding (RRM/RBD/RNP motifs) family protein%3B FUNCTIONS IN: RNA binding%2C nucleotide binding%2C nucleic acid binding%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: chloroplast stroma%2C nucleus%2C chloroplast%2C chloroplast envelope%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: RNA recognition motif%2C RNP-1 (InterPro:IPR000504)%2C Nucleotide-binding%2C alpha-beta plait (InterPro:IPR012677)%3B BEST Arabidopsis thaliana protein match is: RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G60000.1)%3B Has 509067 Blast hits to 499893 proteins in 22124 species: Archae - 10819%3B Bacteria - 303967%3B Metazoa - 99035%3B Fungi - 14863%3B Plants - 31737%3B Viruses - 35534%3B Other Eukaryotes - 13112 (source: NCBI BLink).; Dbxref=PMID:14576160, PMID:15703057, PMID:18650403, locus:2200975; locus_type=protein_coding LOCN Exon COOR C/45610-45954,46044-46145,46376-46789 HITS AT1G01090.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01090.1 CDS ID=AT1G01090.1; Parent=AT1G01090; Name=AT1G01090.1; Note=pyruvate dehydrogenase E1 alpha; curator_summary=pyruvate dehydrogenase E1 alpha subunit; conf_class=2; symbol=PDH-E1 ALPHA; full_name=pyruvate dehydrogenase E1 alpha; computational_description=pyruvate dehydrogenase E1 alpha (PDH-E1 ALPHA)%3B FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring) activity%3B INVOLVED IN: oxidation reduction%2C glycolysis%2C metabolic process%3B LOCATED IN: chloroplast%2C plastid%2C chloroplast envelope%3B EXPRESSED IN: 25 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Dehydrogenase%2C E1 component (InterPro:IPR001017)%2C Pyruvate dehydrogenase (acetyl-transferring) E1 component%2C alpha subunit%2C subgroup y (InterPro:IPR017597)%3B BEST Arabidopsis thaliana protein match is: pyruvate dehydrogenase complex E1 alpha subunit (TAIR:AT1G59900.1)%3B Has 10065 Blast hits to 10059 proteins in 1888 species: Archae - 130%3B Bacteria - 6136%3B Metazoa - 517%3B Fungi - 241%3B Plants - 224%3B Viruses - 0%3B Other Eukaryotes - 2817 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:9393637, PMID:12084821, PMID:12805597, PMID:13677473, PMID:14576160, PMID:14682612, PMID:15052571, PMID:15173569, PMID:15561727, PMID:15703057, PMID:16553896, PMID:17419836, PMID:18650403, PMID:18616834, PMID:18689444, PMID:18775970, PMID:23505340, PMID:24023856, locus:2200980; locus_type=protein_coding LOCN Exon COOR C/47705-47982,48075-48852,48936-49166 HITS AT1G01100.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01100.1 CDS ID=AT1G01100.1; Parent=AT1G01100; Name=AT1G01100.1; Note=60S acidic ribosomal protein family; conf_class=2; computational_description=60S acidic ribosomal protein family%3B FUNCTIONS IN: structural constituent of ribosome%3B INVOLVED IN: translational elongation%3B LOCATED IN: cytosol%2C cytosolic ribosome%2C ribosome%2C nucleus%2C plasma membrane%3B EXPRESSED IN: 25 plant structures%3B EXPRESSED DURING: 14 growth stages%3B CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813)%3B BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein family (TAIR:AT5G47700.2)%3B Has 2175 Blast hits to 2175 proteins in 383 species: Archae - 76%3B Bacteria - 0%3B Metazoa - 858%3B Fungi - 474%3B Plants - 451%3B Viruses - 0%3B Other Eukaryotes - 316 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11598216, PMID:12093376, PMID:14730065, PMID:15010618, PMID:15734919, PMID:15703057, PMID:17934214, PMID:18433157, PMID:18775970, PMID:22195043, locus:2200985; locus_type=protein_coding LOCN Exon COOR C/50284-50337,50419-50631,50883-50954 HITS AT1G01100.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01100.2 CDS ID=AT1G01100.2; Parent=AT1G01100; Name=AT1G01100.2; Note=60S acidic ribosomal protein family; conf_class=2; computational_description=60S acidic ribosomal protein family%3B FUNCTIONS IN: structural constituent of ribosome%3B INVOLVED IN: translational elongation%3B LOCATED IN: cytosol%2C cytosolic ribosome%2C ribosome%2C nucleus%2C plasma membrane%3B EXPRESSED IN: 25 plant structures%3B EXPRESSED DURING: 14 growth stages%3B CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813)%3B BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein family (TAIR:AT5G47700.2)%3B Has 2175 Blast hits to 2175 proteins in 383 species: Archae - 76%3B Bacteria - 0%3B Metazoa - 858%3B Fungi - 474%3B Plants - 451%3B Viruses - 0%3B Other Eukaryotes - 316 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11598216, PMID:12093376, PMID:14730065, PMID:15010618, PMID:15734919, PMID:15703057, PMID:17934214, PMID:18433157, PMID:18775970, PMID:22195043, locus:2200985; locus_type=protein_coding LOCN Exon COOR C/50284-50337,50419-50631,50883-50954 HITS AT1G01100.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01100.3 CDS ID=AT1G01100.3; Parent=AT1G01100; Name=AT1G01100.3; Note=60S acidic ribosomal protein family; conf_class=2; computational_description=60S acidic ribosomal protein family%3B FUNCTIONS IN: structural constituent of ribosome%3B INVOLVED IN: translational elongation%3B LOCATED IN: cytosol%2C cytosolic ribosome%2C ribosome%2C nucleus%2C plasma membrane%3B EXPRESSED IN: 25 plant structures%3B EXPRESSED DURING: 14 growth stages%3B CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813)%3B BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein family (TAIR:AT5G47700.2)%3B Has 2175 Blast hits to 2175 proteins in 383 species: Archae - 76%3B Bacteria - 0%3B Metazoa - 858%3B Fungi - 474%3B Plants - 451%3B Viruses - 0%3B Other Eukaryotes - 316 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11598216, PMID:12093376, PMID:14730065, PMID:15010618, PMID:15734919, PMID:15703057, PMID:17934214, PMID:18433157, PMID:18775970, PMID:22195043, locus:2200985; locus_type=protein_coding LOCN Exon COOR C/50284-50337,50419-50447,50496-50631,50883-50954 HITS AT1G01100.4[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01100.4 CDS ID=AT1G01100.4; Parent=AT1G01100; Name=AT1G01100.4; Note=60S acidic ribosomal protein family; conf_class=2; computational_description=60S acidic ribosomal protein family%3B FUNCTIONS IN: structural constituent of ribosome%3B INVOLVED IN: translational elongation%3B LOCATED IN: cytosol%2C cytosolic ribosome%2C ribosome%2C nucleus%2C plasma membrane%3B EXPRESSED IN: 25 plant structures%3B EXPRESSED DURING: 14 growth stages%3B CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813)%3B BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein family (TAIR:AT5G47700.2)%3B Has 2175 Blast hits to 2175 proteins in 383 species: Archae - 76%3B Bacteria - 0%3B Metazoa - 858%3B Fungi - 474%3B Plants - 451%3B Viruses - 0%3B Other Eukaryotes - 316 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11598216, PMID:12093376, PMID:14730065, PMID:15010618, PMID:15734919, PMID:15703057, PMID:17934214, PMID:18433157, PMID:18775970, PMID:22195043, locus:2200985; locus_type=protein_coding LOCN Exon COOR C/50284-50337,50419-50631,50883-50954 HITS AT1G01110.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01110.2 CDS ID=AT1G01110.2; Parent=AT1G01110; Name=AT1G01110.2; Note=IQ-domain 18; conf_class=2; symbol=IQD18; full_name=IQ-domain 18; computational_description=IQ-domain 18 (IQD18)%3B FUNCTIONS IN: molecular_function unknown%3B LOCATED IN: mitochondrion%3B EXPRESSED IN: 10 plant structures%3B EXPRESSED DURING: 6 growth stages%3B BEST Arabidopsis thaliana protein match is: IQ-domain 17 (TAIR:AT4G00820.1)%3B Has 1112 Blast hits to 678 proteins in 50 species: Archae - 0%3B Bacteria - 10%3B Metazoa - 109%3B Fungi - 16%3B Plants - 528%3B Viruses - 4%3B Other Eukaryotes - 445 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15703057, PMID:16368012, PMID:17551672, locus:2200945; locus_type=protein_coding LOCN Exon COOR W/52239-52346,52434-52730,52938-53183,53484-53624,53703-54494 HITS AT1G01110.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01110.1 CDS ID=AT1G01110.1; Parent=AT1G01110; Name=AT1G01110.1; Note=IQ-domain 18; conf_class=1; symbol=IQD18; full_name=IQ-domain 18; computational_description=IQ-domain 18 (IQD18)%3B FUNCTIONS IN: molecular_function unknown%3B LOCATED IN: mitochondrion%3B EXPRESSED IN: 10 plant structures%3B EXPRESSED DURING: 6 growth stages%3B BEST Arabidopsis thaliana protein match is: IQ-domain 17 (TAIR:AT4G00820.1)%3B Has 1112 Blast hits to 678 proteins in 50 species: Archae - 0%3B Bacteria - 10%3B Metazoa - 109%3B Fungi - 16%3B Plants - 528%3B Viruses - 4%3B Other Eukaryotes - 445 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:15703057, PMID:16368012, PMID:17551672, locus:2200945; locus_type=protein_coding LOCN Exon COOR W/53022-53183,53484-53624,53703-54494 HITS AT1TE00150[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE00150 transposable_element ID=AT1TE00150; Name=AT1TE00150; Alias=SIMPLEHAT1 LOCN Exon COOR W/55676-55873,55874-56576 HITS AT1G01120.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01120.1 CDS ID=AT1G01120.1; Parent=AT1G01120; Name=AT1G01120.1; Note=3-ketoacyl-CoA synthase 1; curator_summary=Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis.; conf_class=1; symbol=KCS1; full_name=3-ketoacyl-CoA synthase 1; computational_description=3-ketoacyl-CoA synthase 1 (KCS1)%3B FUNCTIONS IN: fatty acid elongase activity%2C acyltransferase activity%3B INVOLVED IN: in 7 processes%3B LOCATED IN: cytosolic ribosome%2C endoplasmic reticulum%2C membrane%3B EXPRESSED IN: 29 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Thiolase-like (InterPro:IPR016039)%2C Very-long-chain 3-ketoacyl-CoA synthase (InterPro:IPR012392)%2C 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III C-terminal (InterPro:IPR013747)%2C FAE1/Type III polyketide synthase-like protein (InterPro:IPR013601)%2C Thiolase-like%2C subgroup (InterPro:IPR016038)%3B BEST Arabidopsis thaliana protein match is: 3-ketoacyl-CoA synthase 11 (TAIR:AT2G26640.1)%3B Has 3961 Blast hits to 3946 proteins in 966 species: Archae - 0%3B Bacteria - 1388%3B Metazoa - 0%3B Fungi - 5%3B Plants - 2408%3B Viruses - 0%3B Other Eukaryotes - 160 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:10074711, PMID:11341960, PMID:12753585, PMID:15070782, PMID:18465198, PMID:18650403, PMID:20736450, PMID:22284369, PMID:23505340, locus:2200955; locus_type=protein_coding LOCN Exon COOR C/57392-58978 HITS AT1G01130.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01130.1 CDS ID=AT1G01130.1; Parent=AT1G01130; Name=AT1G01130.1; Note=CBL-interacting Serine/Threonine-kinase; conf_class=3; computational_description=CONTAINS InterPro DOMAIN/s: CBL-interacting protein kinase (InterPro:IPR020660)%2C Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636)%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47170.1)%3B Has 176 Blast hits to 176 proteins in 20 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 176%3B Viruses - 0%3B Other Eukaryotes - 0 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15703057, PMID:20226671, locus:2035357; locus_type=protein_coding LOCN Exon COOR C/61905-61949,62050-62124,63557-63811 HITS AT1G01140.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01140.1 CDS ID=AT1G01140.1; Parent=AT1G01140; Name=AT1G01140.1; Note=CBL-interacting protein kinase 9; curator_summary=Encodes a CBL-interacting protein kinase with similarity to SOS2; conf_class=2; symbol=CIPK9; Alias=PKS6, PROTEIN KINASE 6, SnRK3.12, SNF1-RELATED PROTEIN KINASE 3.12; full_name=CBL-interacting protein kinase 9; computational_description=CBL-interacting protein kinase 9 (CIPK9)%3B FUNCTIONS IN: protein serine/threonine kinase activity%2C protein kinase activity%2C kinase activity%2C ATP binding%3B INVOLVED IN: in 6 processes%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein kinase%2C ATP binding site (InterPro:IPR017441)%2C NAF/FISL domain (InterPro:IPR018451)%2C Serine/threonine-protein kinase domain (InterPro:IPR002290)%2C Serine/threonine-protein kinase-like domain (InterPro:IPR017442)%2C Protein kinase-like domain (InterPro:IPR011009)%2C Serine/threonine-protein kinase%2C active site (InterPro:IPR008271)%2C CBL-interacting protein kinase (InterPro:IPR020660)%2C NAF domain (InterPro:IPR004041)%2C Protein kinase%2C catalytic domain (InterPro:IPR000719)%2C Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636)%2C Tyrosine-protein kinase%2C catalytic domain (InterPro:IPR020635)%3B BEST Arabidopsis thaliana protein match is: CBL-interacting protein kinase 23 (TAIR:AT1G30270.1)%3B Has 130203 Blast hits to 128118 proteins in 4349 species: Archae - 165%3B Bacteria - 15262%3B Metazoa - 47961%3B Fungi - 13206%3B Plants - 31482%3B Viruses - 522%3B Other Eukaryotes - 21605 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11230129, PMID:12805596, PMID:12045290, PMID:14730064, PMID:15574398, PMID:15703057, PMID:16146321, PMID:16214899, PMID:16673935, PMID:17397506, PMID:17551672, PMID:18650403, PMID:18775970, PMID:17486125, PMID:20870959, PMID:21477822, PMID:23109687, PMID:25614064, PMID:25646412, locus:2035367; locus_type=protein_coding LOCN Exon COOR C/64398-64475,64582-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65739-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67512 HITS AT1G01140.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01140.2 CDS ID=AT1G01140.2; Parent=AT1G01140; Name=AT1G01140.2; Note=CBL-interacting protein kinase 9; curator_summary=Encodes a CBL-interacting protein kinase with similarity to SOS2; conf_class=3; symbol=CIPK9; Alias=PKS6, PROTEIN KINASE 6, SnRK3.12, SNF1-RELATED PROTEIN KINASE 3.12; full_name=CBL-interacting protein kinase 9; computational_description=CBL-interacting protein kinase 9 (CIPK9)%3B FUNCTIONS IN: protein serine/threonine kinase activity%2C protein kinase activity%2C kinase activity%2C ATP binding%3B INVOLVED IN: in 6 processes%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein kinase%2C ATP binding site (InterPro:IPR017441)%2C NAF/FISL domain (InterPro:IPR018451)%2C Serine/threonine-protein kinase domain (InterPro:IPR002290)%2C Serine/threonine-protein kinase-like domain (InterPro:IPR017442)%2C Protein kinase-like domain (InterPro:IPR011009)%2C Serine/threonine-protein kinase%2C active site (InterPro:IPR008271)%2C CBL-interacting protein kinase (InterPro:IPR020660)%2C NAF domain (InterPro:IPR004041)%2C Protein kinase%2C catalytic domain (InterPro:IPR000719)%2C Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636)%2C Tyrosine-protein kinase%2C catalytic domain (InterPro:IPR020635)%3B BEST Arabidopsis thaliana protein match is: CBL-interacting protein kinase 23 (TAIR:AT1G30270.1)%3B Has 130203 Blast hits to 128118 proteins in 4349 species: Archae - 165%3B Bacteria - 15262%3B Metazoa - 47961%3B Fungi - 13206%3B Plants - 31482%3B Viruses - 522%3B Other Eukaryotes - 21605 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11230129, PMID:12805596, PMID:12045290, PMID:14730064, PMID:15574398, PMID:15703057, PMID:16146321, PMID:16214899, PMID:16673935, PMID:17397506, PMID:17551672, PMID:18650403, PMID:18775970, PMID:17486125, PMID:20870959, PMID:21477822, PMID:23109687, PMID:25614064, PMID:25646412, locus:2035367; locus_type=protein_coding LOCN Exon COOR C/64398-64475,64582-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65733-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67512 HITS AT1G01140.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01140.3 CDS ID=AT1G01140.3; Parent=AT1G01140; Name=AT1G01140.3; Note=CBL-interacting protein kinase 9; curator_summary=Encodes a CBL-interacting protein kinase with similarity to SOS2; conf_class=2; symbol=CIPK9; Alias=PKS6, PROTEIN KINASE 6, SnRK3.12, SNF1-RELATED PROTEIN KINASE 3.12; full_name=CBL-interacting protein kinase 9; computational_description=CBL-interacting protein kinase 9 (CIPK9)%3B FUNCTIONS IN: protein serine/threonine kinase activity%2C protein kinase activity%2C kinase activity%2C ATP binding%3B INVOLVED IN: in 6 processes%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein kinase%2C ATP binding site (InterPro:IPR017441)%2C NAF/FISL domain (InterPro:IPR018451)%2C Serine/threonine-protein kinase domain (InterPro:IPR002290)%2C Serine/threonine-protein kinase-like domain (InterPro:IPR017442)%2C Protein kinase-like domain (InterPro:IPR011009)%2C Serine/threonine-protein kinase%2C active site (InterPro:IPR008271)%2C CBL-interacting protein kinase (InterPro:IPR020660)%2C NAF domain (InterPro:IPR004041)%2C Protein kinase%2C catalytic domain (InterPro:IPR000719)%2C Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636)%2C Tyrosine-protein kinase%2C catalytic domain (InterPro:IPR020635)%3B BEST Arabidopsis thaliana protein match is: CBL-interacting protein kinase 23 (TAIR:AT1G30270.1)%3B Has 130203 Blast hits to 128118 proteins in 4349 species: Archae - 165%3B Bacteria - 15262%3B Metazoa - 47961%3B Fungi - 13206%3B Plants - 31482%3B Viruses - 522%3B Other Eukaryotes - 21605 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11230129, PMID:12805596, PMID:12045290, PMID:14730064, PMID:15574398, PMID:15703057, PMID:16146321, PMID:16214899, PMID:16673935, PMID:17397506, PMID:17551672, PMID:18650403, PMID:18775970, PMID:17486125, PMID:20870959, PMID:21477822, PMID:23109687, PMID:25614064, PMID:25646412, locus:2035367; locus_type=protein_coding LOCN Exon COOR C/64398-64475,64570-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65739-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67512 HITS AT1G01150.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01150.1 CDS ID=AT1G01150.1; Parent=AT1G01150; Name=AT1G01150.1; Note=Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain-containing protein; conf_class=6; computational_description=Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain%3B FUNCTIONS IN: DNA binding%2C zinc ion binding%3B INVOLVED IN: regulation of transcription%3B EXPRESSED IN: 8 plant structures%3B EXPRESSED DURING: 4 anthesis%2C petal differentiation and expansion stage%2C E expanded cotyledon stage%2C D bilateral stage%3B CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057)%2C Zinc finger%2C PHD-type%2C conserved site (InterPro:IPR019786)%2C Zinc finger%2C FYVE/PHD-type (InterPro:IPR011011)%2C Homeodomain-related (InterPro:IPR012287)%2C MYB-like (InterPro:IPR017877)%3B BEST Arabidopsis thaliana protein match is: TRF-like 10 (TAIR:AT5G03780.1)%3B Has 94 Blast hits to 77 proteins in 18 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 5%3B Fungi - 0%3B Plants - 86%3B Viruses - 0%3B Other Eukaryotes - 3 (source: NCBI BLink).; conf_rating=**; Dbxref=PMID:15703057, PMID:16481336, locus:2035372; locus_type=protein_coding LOCN Exon COOR C/70115-70285,70840-70968,71041-71721,71942-71998 HITS AT1G01150.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01150.2 CDS ID=AT1G01150.2; Parent=AT1G01150; Name=AT1G01150.2; Note=Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain-containing protein; computational_description=Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain%3B FUNCTIONS IN: DNA binding%2C zinc ion binding%3B INVOLVED IN: regulation of transcription%3B EXPRESSED IN: 8 plant structures%3B EXPRESSED DURING: 4 anthesis%2C petal differentiation and expansion stage%2C E expanded cotyledon stage%2C D bilateral stage%3B CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057)%2C Zinc finger%2C PHD-type%2C conserved site (InterPro:IPR019786)%2C Zinc finger%2C FYVE/PHD-type (InterPro:IPR011011)%2C Homeodomain-related (InterPro:IPR012287)%2C MYB-like (InterPro:IPR017877)%3B BEST Arabidopsis thaliana protein match is: TRF-like 10 (TAIR:AT5G03780.1)%3B Has 94 Blast hits to 77 proteins in 18 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 5%3B Fungi - 0%3B Plants - 86%3B Viruses - 0%3B Other Eukaryotes - 3 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:16481336, locus:2035372; locus_type=protein_coding LOCN Exon COOR C/70115-70233,70896-70968,71041-71721,71942-71998 HITS AT1G01150.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01150.3 CDS ID=AT1G01150.3; Parent=AT1G01150; Name=AT1G01150.3; Note=Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain-containing protein; computational_description=Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain%3B FUNCTIONS IN: DNA binding%2C zinc ion binding%3B INVOLVED IN: regulation of transcription%3B EXPRESSED IN: 8 plant structures%3B EXPRESSED DURING: 4 anthesis%2C petal differentiation and expansion stage%2C E expanded cotyledon stage%2C D bilateral stage%3B CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057)%2C Zinc finger%2C PHD-type%2C conserved site (InterPro:IPR019786)%2C Zinc finger%2C FYVE/PHD-type (InterPro:IPR011011)%2C Homeodomain-related (InterPro:IPR012287)%2C MYB-like (InterPro:IPR017877)%3B BEST Arabidopsis thaliana protein match is: TRF-like 10 (TAIR:AT5G03780.1)%3B Has 94 Blast hits to 77 proteins in 18 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 5%3B Fungi - 0%3B Plants - 86%3B Viruses - 0%3B Other Eukaryotes - 3 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:16481336, locus:2035372; locus_type=protein_coding LOCN Exon COOR C/70828-70968,71041-71721,71942-71998 HITS AT1G01160.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01160.1 CDS ID=AT1G01160.1; Parent=AT1G01160; Name=AT1G01160.1; Note=GRF1-interacting factor 2; curator_summary=Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA; conf_class=2; symbol=GIF2; full_name=GRF1-interacting factor 2; computational_description=GRF1-interacting factor 2 (GIF2)%3B CONTAINS InterPro DOMAIN/s: SSXT (InterPro:IPR007726)%3B BEST Arabidopsis thaliana protein match is: GRF1-interacting factor 3 (TAIR:AT4G00850.1)%3B Has 425 Blast hits to 425 proteins in 91 species: Archae - 0%3B Bacteria - 4%3B Metazoa - 291%3B Fungi - 20%3B Plants - 89%3B Viruses - 0%3B Other Eukaryotes - 21 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:12974814, PMID:15326298, PMID:15703057, PMID:17182867, PMID:19648231, PMID:22589469, PMID:22669825, PMID:24355747, locus:2035232; locus_type=protein_coding LOCN Exon COOR W/72583-72669,73087-73163,73287-73395,73488-73740,73822-73883 HITS AT1G01160.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01160.2 CDS ID=AT1G01160.2; Parent=AT1G01160; Name=AT1G01160.2; Note=GRF1-interacting factor 2; curator_summary=Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA; conf_class=6; symbol=GIF2; full_name=GRF1-interacting factor 2; computational_description=GRF1-interacting factor 2 (GIF2)%3B CONTAINS InterPro DOMAIN/s: SSXT (InterPro:IPR007726)%3B BEST Arabidopsis thaliana protein match is: GRF1-interacting factor 3 (TAIR:AT4G00850.1)%3B Has 425 Blast hits to 425 proteins in 91 species: Archae - 0%3B Bacteria - 4%3B Metazoa - 291%3B Fungi - 20%3B Plants - 89%3B Viruses - 0%3B Other Eukaryotes - 21 (source: NCBI BLink).; conf_rating=**; Dbxref=PMID:12974814, PMID:15326298, PMID:15703057, PMID:17182867, PMID:19648231, PMID:22589469, PMID:22669825, PMID:24355747, locus:2035232; locus_type=protein_coding LOCN Exon COOR W/72583-72669,72915-73016,73087-73163,73287-73395,73488-73740,73822-73883 HITS AT1G04007.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G04007.1 antisense_lncRNA ID=AT1G04007.1; Parent=AT1G04007; Name=AT1G04007.1; description=Natural antisense transcript overlaps with AT1G01160; Note=Natural antisense transcript overlaps with AT1G01160; locus_type=antisense_long_noncoding_rna LOCN Exon COOR C/72646-73108 HITS AT1G01170.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01170.1 CDS ID=AT1G01170.1; Parent=AT1G01170; Name=AT1G01170.1; Note=ozone-responsive stress-like protein (DUF1138); conf_class=2; computational_description=Protein of unknown function (DUF1138)%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: response to stress%3B LOCATED IN: mitochondrion%2C membrane%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1138 (InterPro:IPR009515)%3B BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1138) (TAIR:AT4G00860.1)%3B Has 86 Blast hits to 86 proteins in 15 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 86%3B Viruses - 0%3B Other Eukaryotes - 0 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15703057, PMID:16055634, PMID:17059406, PMID:17432890, locus:2035247; locus_type=protein_coding LOCN Exon COOR C/74105-74250,74338-74443 HITS AT1G01170.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01170.2 CDS ID=AT1G01170.2; Parent=AT1G01170; Name=AT1G01170.2; Note=ozone-responsive stress-like protein (DUF1138); conf_class=2; computational_description=Protein of unknown function (DUF1138)%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: response to stress%3B LOCATED IN: mitochondrion%2C membrane%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1138 (InterPro:IPR009515)%3B BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1138) (TAIR:AT4G00860.1)%3B Has 86 Blast hits to 86 proteins in 15 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 86%3B Viruses - 0%3B Other Eukaryotes - 0 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15703057, PMID:16055634, PMID:17059406, PMID:17432890, locus:2035247; locus_type=protein_coding LOCN Exon COOR C/74105-74250,74338-74443 HITS AT1G04013.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G04013.1 antisense_lncRNA ID=AT1G04013.1; Parent=AT1G04013; Name=AT1G04013.1; description=Natural antisense transcript overlaps with AT1G01170; Note=Natural antisense transcript overlaps with AT1G01170; locus_type=antisense_long_noncoding_rna LOCN Exon COOR W/74435-74683 HITS AT1G01180.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01180.1 CDS ID=AT1G01180.1; Parent=AT1G01180; Name=AT1G01180.1; Note=S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; conf_class=1; computational_description=S-adenosyl-L-methionine-dependent methyltransferases superfamily protein%3B FUNCTIONS IN: methyltransferase activity%3B INVOLVED IN: lipid biosynthetic process%3B EXPRESSED IN: sperm cell%2C hypocotyl%3B CONTAINS InterPro DOMAIN/s: Rhamnosyl O-methyltransferase/Cephalosporin hydroxylase (InterPro:IPR007072)%3B Has 274 Blast hits to 274 proteins in 51 species: Archae - 0%3B Bacteria - 75%3B Metazoa - 2%3B Fungi - 0%3B Plants - 46%3B Viruses - 0%3B Other Eukaryotes - 151 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:12101121, PMID:15703057, PMID:16520461, locus:2035262; locus_type=protein_coding LOCN Exon COOR W/75633-76556 HITS AT1TE00220[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE00220 transposable_element ID=AT1TE00220; Name=AT1TE00220; Alias=TA11 LOCN Exon COOR W/76844-77500 HITS AT1G08765.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G08765.1 transcript_region ID=AT1G08765.1; Parent=AT1G08765; computational_description=novel transcribed region; Name=AT1G08765.1; locus_type=novel_transcribed_region LOCN Exon COOR W/77537-80345 HITS AT1G08765.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G08765.2 transcript_region ID=AT1G08765.2; Parent=AT1G08765; computational_description=novel transcribed region; Name=AT1G08765.2; locus_type=novel_transcribed_region LOCN Exon COOR W/77727-79340 HITS AT1TE00225[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE00225 transposable_element ID=AT1TE00225; Name=AT1TE00225; Alias=HELITRONY1D LOCN Exon COOR C/78288-78785 HITS AT1G01183.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01183.1 miRNA_primary_transcript ID=AT1G01183.1; Parent=AT1G01183; Alias=p_MI0000199; Name=ath-MIR165a; symbol=MIR165A; curator_summary=Encodes a microRNA that targets several HD-ZIPIII family members including PHV%2C PHB%2C REV%2C ATHB-8%2C and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC; Note=microRNA ath-MIR165a precursor; full_name=microRNA165A; Dbxref=PMID:15200956, PMID:18794352, PMID:19054365, PMID:17549070, PMID:19704656, PMID:19879265, PMID:20410882, PMID:21483759, PMID:21558378, PMID:21610018, PMID:22476466, PMID:22589131, PMID:22951404, PMID:23292599, PMID:23645346, PMID:23918970, PMID:23935517, PMID:24296072, locus:1009023078, PMID:15200956, PMID:18794352, PMID:19054365, PMID:17549070, PMID:19704656, PMID:19879265, PMID:20410882, PMID:21483759, PMID:21558378, PMID:21610018, PMID:22476466, PMID:22589131, PMID:22951404, PMID:23292599, PMID:23645346, PMID:23918970, PMID:23935517, PMID:24296072, PMID:25406978, PMID:25711809, locus:1009023078; locus_type=mirna LOCN Exon COOR C/78927-79037 HITS ath-miR165a-3p[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL ath-miR165a-3p miRNA ID=ath-miR165a-3p; Alias=MIMAT0000187; Name=ath-miR165a-3p; Derives_from=AT1G01183.1; Note=microRNA ath-miR165a-3p; computational_description=mature miRNA accession:MIMAT0000187 LOCN Exon COOR C/78932-78952 HITS ath-miR165a-5p[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL ath-miR165a-5p miRNA ID=ath-miR165a-5p; Alias=MIMAT0031879; Name=ath-miR165a-5p; Derives_from=AT1G01183.1; Note=microRNA ath-miR165a-5p; computational_description=mature miRNA accession:MIMAT0031879 LOCN Exon COOR C/79010-79030 HITS AT1G01190.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01190.1 CDS ID=AT1G01190.1; Parent=AT1G01190; Name=AT1G01190.1; Note=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8; curator_summary=member of CYP78A; conf_class=2; symbol=CYP78A8; full_name=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8; computational_description=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8 (CYP78A8)%3B FUNCTIONS IN: electron carrier activity%2C monooxygenase activity%2C iron ion binding%2C oxygen binding%2C heme binding%3B INVOLVED IN: oxidation reduction%3B LOCATED IN: endomembrane system%3B EXPRESSED IN: 6 plant structures%3B EXPRESSED DURING: LP.10 ten leaves visible%2C LP.02 two leaves visible%2C LP.12 twelve leaves visible%3B CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128)%2C Cytochrome P450%2C conserved site (InterPro:IPR017972)%2C Cytochrome P450%2C E-class%2C group I (InterPro:IPR002401)%3B BEST Arabidopsis thaliana protein match is: cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 6 (TAIR:AT2G46660.1)%3B Has 32104 Blast hits to 32001 proteins in 1725 species: Archae - 48%3B Bacteria - 3617%3B Metazoa - 11430%3B Fungi - 6777%3B Plants - 9112%3B Viruses - 3%3B Other Eukaryotes - 1117 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15280363, PMID:15546358, PMID:15703057, PMID:16520461, PMID:15604721, PMID:18650403, PMID:20736450, PMID:23610218, PMID:23733073, locus:2035282; locus_type=protein_coding LOCN Exon COOR C/83045-83671,83884-84864 HITS AT1G01190.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01190.2 CDS ID=AT1G01190.2; Parent=AT1G01190; Name=AT1G01190.2; Note=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8; symbol=CYP78A8; full_name=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8; curator_summary=member of CYP78A; computational_description=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8 (CYP78A8)%3B FUNCTIONS IN: electron carrier activity%2C monooxygenase activity%2C iron ion binding%2C oxygen binding%2C heme binding%3B INVOLVED IN: oxidation reduction%3B LOCATED IN: endomembrane system%3B EXPRESSED IN: 6 plant structures%3B EXPRESSED DURING: LP.10 ten leaves visible%2C LP.02 two leaves visible%2C LP.12 twelve leaves visible%3B CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128)%2C Cytochrome P450%2C conserved site (InterPro:IPR017972)%2C Cytochrome P450%2C E-class%2C group I (InterPro:IPR002401)%3B BEST Arabidopsis thaliana protein match is: cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 6 (TAIR:AT2G46660.1)%3B Has 32104 Blast hits to 32001 proteins in 1725 species: Archae - 48%3B Bacteria - 3617%3B Metazoa - 11430%3B Fungi - 6777%3B Plants - 9112%3B Viruses - 3%3B Other Eukaryotes - 1117 (source: NCBI BLink).; Dbxref=PMID:15280363, PMID:15546358, PMID:15703057, PMID:16520461, PMID:15604721, PMID:18650403, PMID:20736450, PMID:23610218, PMID:23733073, locus:2035282; locus_type=protein_coding LOCN Exon COOR C/83045-83671,83884-84879 HITS AT1G01200.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01200.1 CDS ID=AT1G01200.1; Parent=AT1G01200; Name=AT1G01200.1; Note=RAB GTPase homolog A3; conf_class=1; symbol=RABA3; Alias=ATRAB-A3, ARABIDOPSIS RAB GTPASE HOMOLOG A3, ATRABA3, RAB GTPase homolog A3; full_name=RAB GTPase homolog A3; computational_description=RAB GTPase homolog A3 (RABA3)%3B FUNCTIONS IN: GTP binding%3B INVOLVED IN: protein transport%2C small GTPase mediated signal transduction%3B LOCATED IN: endosome%2C nucleus%2C cell plate%3B EXPRESSED IN: lateral root cap%2C hypocotyl%2C root%2C flower%2C epidermis%3B EXPRESSED DURING: petal differentiation and expansion stage%3B CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806)%2C Small GTP-binding protein (InterPro:IPR005225)%2C Small GTPase (InterPro:IPR020851)%2C Ras (InterPro:IPR013753)%2C Ras small GTPase%2C Rab type (InterPro:IPR003579)%2C Rab11-related (InterPro:IPR015595)%3B BEST Arabidopsis thaliana protein match is: RAB GTPase homolog A4C (TAIR:AT5G47960.1)%3B Has 27164 Blast hits to 27137 proteins in 734 species: Archae - 19%3B Bacteria - 134%3B Metazoa - 14292%3B Fungi - 3779%3B Plants - 3194%3B Viruses - 20%3B Other Eukaryotes - 5726 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:12644670, PMID:15703057, PMID:16581873, PMID:18239134, locus:2035302; locus_type=protein_coding LOCN Exon COOR C/86715-87162,87880-88145 HITS AT1G01210.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01210.1 CDS ID=AT1G01210.1; Parent=AT1G01210; Name=AT1G01210.1; Note=DNA-directed RNA polymerase%2C subunit M%2C archaeal; conf_class=1; computational_description=DNA-directed RNA polymerase%2C subunit M%2C archaeal%3B FUNCTIONS IN: in 6 functions%3B INVOLVED IN: RNA elongation%2C regulation of transcription%2C DNA-dependent%2C transcription%2C regulation of transcription%3B LOCATED IN: nucleus%3B CONTAINS InterPro DOMAIN/s: Zinc finger%2C TFIIS-type (InterPro:IPR001222)%2C DNA-directed RNA polymerase%2C M/15kDa subunit (InterPro:IPR001529)%2C DNA-directed RNA polymerase%2C subunit M%2C archaeal (InterPro:IPR006288)%2C DNA-directed RNA polymerase M%2C 15kDa subunit%2C conserved site (InterPro:IPR019761)%3B BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase%2C subunit M%2C archaeal (TAIR:AT4G07950.1)%3B Has 1129 Blast hits to 1129 proteins in 326 species: Archae - 242%3B Bacteria - 0%3B Metazoa - 276%3B Fungi - 294%3B Plants - 112%3B Viruses - 0%3B Other Eukaryotes - 205 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:17447913, locus:2035322; locus_type=protein_coding LOCN Exon COOR W/88977-89081,89173-89263,89405-89529 HITS AT1G01210.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01210.2 CDS ID=AT1G01210.2; Parent=AT1G01210; Name=AT1G01210.2; Note=DNA-directed RNA polymerase%2C subunit M%2C archaeal; Dbxref=PMID:17447913, locus:2035322; computational_description=DNA-directed RNA polymerase%2C subunit M%2C archaeal%3B FUNCTIONS IN: in 6 functions%3B INVOLVED IN: RNA elongation%2C regulation of transcription%2C DNA-dependent%2C transcription%2C regulation of transcription%3B LOCATED IN: nucleus%3B CONTAINS InterPro DOMAIN/s: Zinc finger%2C TFIIS-type (InterPro:IPR001222)%2C DNA-directed RNA polymerase%2C M/15kDa subunit (InterPro:IPR001529)%2C DNA-directed RNA polymerase%2C subunit M%2C archaeal (InterPro:IPR006288)%2C DNA-directed RNA polymerase M%2C 15kDa subunit%2C conserved site (InterPro:IPR019761)%3B BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase%2C subunit M%2C archaeal (TAIR:AT4G07950.1)%3B Has 1129 Blast hits to 1129 proteins in 326 species: Archae - 242%3B Bacteria - 0%3B Metazoa - 276%3B Fungi - 294%3B Plants - 112%3B Viruses - 0%3B Other Eukaryotes - 205 (source: NCBI BLink).; locus_type=protein_coding LOCN Exon COOR W/88977-89081,89173-89263,89405-89529 HITS AT1G01210.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01210.3 CDS ID=AT1G01210.3; Parent=AT1G01210; Name=AT1G01210.3; Note=DNA-directed RNA polymerase%2C subunit M%2C archaeal; Dbxref=PMID:17447913, locus:2035322; computational_description=DNA-directed RNA polymerase%2C subunit M%2C archaeal%3B FUNCTIONS IN: in 6 functions%3B INVOLVED IN: RNA elongation%2C regulation of transcription%2C DNA-dependent%2C transcription%2C regulation of transcription%3B LOCATED IN: nucleus%3B CONTAINS InterPro DOMAIN/s: Zinc finger%2C TFIIS-type (InterPro:IPR001222)%2C DNA-directed RNA polymerase%2C M/15kDa subunit (InterPro:IPR001529)%2C DNA-directed RNA polymerase%2C subunit M%2C archaeal (InterPro:IPR006288)%2C DNA-directed RNA polymerase M%2C 15kDa subunit%2C conserved site (InterPro:IPR019761)%3B BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase%2C subunit M%2C archaeal (TAIR:AT4G07950.1)%3B Has 1129 Blast hits to 1129 proteins in 326 species: Archae - 242%3B Bacteria - 0%3B Metazoa - 276%3B Fungi - 294%3B Plants - 112%3B Viruses - 0%3B Other Eukaryotes - 205 (source: NCBI BLink).; locus_type=protein_coding LOCN Exon COOR W/88977-89081,89173-89263,89405-89529 HITS AT1G04017.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G04017.1 lnc_RNA ID=AT1G04017.1; Parent=AT1G04017; Name=AT1G04017.1; locus_type=long_noncoding_rna LOCN Exon COOR C/90169-90401 HITS AT1G04023.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G04023.1 lnc_RNA ID=AT1G04023.1; Parent=AT1G04023; Name=AT1G04023.1; locus_type=long_noncoding_rna LOCN Exon COOR C/91356-91685 HITS AT1G01220.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.1 CDS ID=AT1G01220.1; Parent=AT1G01220; Name=AT1G01220.1; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; conf_class=6; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; conf_rating=**; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; locus_type=protein_coding LOCN Exon COOR W/91750-92070,92270-92501,92569-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01220.7[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.7 CDS ID=AT1G01220.7; Parent=AT1G01220; Name=AT1G01220.7; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; locus_type=protein_coding LOCN Exon COOR W/91750-92070,92270-92501,92569-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01220.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.3 CDS ID=AT1G01220.3; Parent=AT1G01220; Name=AT1G01220.3; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; locus_type=protein_coding LOCN Exon COOR W/92246-92501,92569-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01220.8[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.8 CDS ID=AT1G01220.8; Parent=AT1G01220; Name=AT1G01220.8; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; locus_type=protein_coding LOCN Exon COOR W/92246-92501,92569-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01220.4[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.4 CDS ID=AT1G01220.4; Parent=AT1G01220; Name=AT1G01220.4; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; locus_type=protein_coding LOCN Exon COOR W/92270-92501,92569-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01220.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.2 CDS ID=AT1G01220.2; Parent=AT1G01220; Name=AT1G01220.2; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; locus_type=protein_coding LOCN Exon COOR W/92583-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01220.5[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.5 CDS ID=AT1G01220.5; Parent=AT1G01220; Name=AT1G01220.5; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; locus_type=protein_coding LOCN Exon COOR W/92583-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01220.6[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.6 CDS ID=AT1G01220.6; Parent=AT1G01220; Name=AT1G01220.6; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; locus_type=protein_coding LOCN Exon COOR W/92583-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01225.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01225.1 CDS ID=AT1G01225.1; Parent=AT1G01225; Name=AT1G01225.1; Note=NC domain-containing protein-like protein; conf_class=1; computational_description=NC domain-containing protein-related%3B CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053)%3B BEST Arabidopsis thaliana protein match is: NC domain-containing protein-related (TAIR:AT4G00905.1)%3B Has 173 Blast hits to 172 proteins in 34 species: Archae - 0%3B Bacteria - 24%3B Metazoa - 5%3B Fungi - 0%3B Plants - 139%3B Viruses - 0%3B Other Eukaryotes - 5 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:15703057, PMID:22589469, locus:505006091; locus_type=protein_coding LOCN Exon COOR W/96064-96157,96554-97242 HITS AT1G01230.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01230.1 CDS ID=AT1G01230.1; Parent=AT1G01230; Name=AT1G01230.1; Note=ORMDL family protein; conf_class=2; computational_description=ORMDL family protein%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: protein folding%3B LOCATED IN: integral to membrane%2C endoplasmic reticulum%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203)%3B BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT5G42000.1)%3B Has 538 Blast hits to 538 proteins in 163 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 276%3B Fungi - 148%3B Plants - 90%3B Viruses - 0%3B Other Eukaryotes - 24 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15703057, PMID:18775970, locus:2035352; locus_type=protein_coding LOCN Exon COOR W/97620-97805,98457-98605,98908-99046 HITS AT1G01240.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01240.1 CDS ID=AT1G01240.1; Parent=AT1G01240; Name=AT1G01240.1; Note=transmembrane protein; conf_class=4; computational_description=unknown protein%3B INVOLVED IN: N-terminal protein myristoylation%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 11 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1)%3B Has 95 Blast hits to 78 proteins in 16 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 11%3B Fungi - 0%3B Plants - 80%3B Viruses - 0%3B Other Eukaryotes - 2 (source: NCBI BLink).; conf_rating=***; Dbxref=PMID:12912986, PMID:15703057, PMID:23517122, locus:2035242; locus_type=protein_coding LOCN Exon COOR W/100683-101678 HITS AT1G01240.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01240.2 CDS ID=AT1G01240.2; Parent=AT1G01240; Name=AT1G01240.2; Note=transmembrane protein; conf_class=2; computational_description=unknown protein%3B INVOLVED IN: N-terminal protein myristoylation%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 11 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1)%3B Has 95 Blast hits to 78 proteins in 16 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 11%3B Fungi - 0%3B Plants - 80%3B Viruses - 0%3B Other Eukaryotes - 2 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:12912986, PMID:15703057, PMID:23517122, locus:2035242; locus_type=protein_coding LOCN Exon COOR W/100683-101678 HITS AT1G01240.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01240.3 CDS ID=AT1G01240.3; Parent=AT1G01240; Name=AT1G01240.3; Note=transmembrane protein; conf_class=4; computational_description=unknown protein%3B INVOLVED IN: N-terminal protein myristoylation%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 11 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1)%3B Has 95 Blast hits to 78 proteins in 16 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 11%3B Fungi - 0%3B Plants - 80%3B Viruses - 0%3B Other Eukaryotes - 2 (source: NCBI BLink).; conf_rating=***; Dbxref=PMID:12912986, PMID:15703057, PMID:23517122, locus:2035242; locus_type=protein_coding LOCN Exon COOR W/100683-101678 HITS AT1G01240.4[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01240.4 CDS ID=AT1G01240.4; Parent=AT1G01240; Name=AT1G01240.4; Note=transmembrane protein; Dbxref=PMID:12912986, PMID:15703057, PMID:23517122, locus:2035242; computational_description=unknown protein%3B INVOLVED IN: N-terminal protein myristoylation%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 11 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1)%3B Has 95 Blast hits to 78 proteins in 16 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 11%3B Fungi - 0%3B Plants - 80%3B Viruses - 0%3B Other Eukaryotes - 2 (source: NCBI BLink).; locus_type=protein_coding LOCN Exon COOR W/100683-101678 HITS AT1G01240.5[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01240.5 CDS ID=AT1G01240.5; Parent=AT1G01240; Name=AT1G01240.5; Note=transmembrane protein; Dbxref=PMID:12912986, PMID:15703057, PMID:23517122, locus:2035242; computational_description=unknown protein%3B INVOLVED IN: N-terminal protein myristoylation%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 11 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1)%3B Has 95 Blast hits to 78 proteins in 16 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 11%3B Fungi - 0%3B Plants - 80%3B Viruses - 0%3B Other Eukaryotes - 2 (source: NCBI BLink).; locus_type=protein_coding LOCN Exon COOR W/100683-101678 HITS AT1G01250.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01250.1 CDS ID=AT1G01250.1; Parent=AT1G01250; Name=AT1G01250.1; Note=Integrase-type DNA-binding superfamily protein; curator_summary=encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.; conf_class=1; computational_description=Integrase-type DNA-binding superfamily protein%3B FUNCTIONS IN: DNA binding%2C sequence-specific DNA binding transcription factor activity%3B INVOLVED IN: regulation of transcription%2C DNA-dependent%3B LOCATED IN: nucleus%2C chloroplast%3B EXPRESSED IN: 10 plant structures%3B EXPRESSED DURING: 6 growth stages%3B CONTAINS InterPro DOMAIN/s: DNA-binding%2C integrase-type (InterPro:IPR016177)%2C Pathogenesis-related transcriptional factor/ERF%2C DNA-binding (InterPro:IPR001471)%3B BEST Arabidopsis thaliana protein match is: Integrase-type DNA-binding superfamily protein (TAIR:AT5G25810.1)%3B Has 5404 Blast hits to 5361 proteins in 232 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 5399%3B Viruses - 0%3B Other Eukaryotes - 5 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:11118137, PMID:14576160, PMID:15010618, PMID:15703057, PMID:16151182, PMID:17316173, PMID:17885809, PMID:18230180, PMID:24377444, locus:2035257; locus_type=protein_coding LOCN Exon COOR C/104731-105309 HITS AT1G01260.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01260.1 CDS ID=AT1G01260.1; Parent=AT1G01260; Name=AT1G01260.1; Note=basic helix-loop-helix (bHLH) DNA-binding superfamily protein; conf_class=1; Alias=JAM2, Jasmonate Associated MYC2 LIKE 2; computational_description=basic helix-loop-helix (bHLH) DNA-binding superfamily protein%3B FUNCTIONS IN: DNA binding%2C sequence-specific DNA binding transcription factor activity%3B INVOLVED IN: regulation of transcription%3B LOCATED IN: nucleus%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092)%2C Helix-loop-helix DNA-binding (InterPro:IPR011598)%3B BEST Arabidopsis thaliana protein match is: ABA-inducible BHLH-type transcription factor (TAIR:AT2G46510.1)%3B Has 3647 Blast hits to 3273 proteins in 223 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 174%3B Fungi - 93%3B Plants - 3336%3B Viruses - 0%3B Other Eukaryotes - 42 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:11118137, PMID:12679534, PMID:12897250, PMID:14600211, PMID:15703057, PMID:16944199, PMID:17828375, PMID:18775970, PMID:21889054, PMID:22037706, PMID:23852442, PMID:24056034, PMID:24465948, locus:2035237; locus_type=protein_coding LOCN Exon COOR W/109595-111367 HITS AT1G01260.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01260.2 CDS ID=AT1G01260.2; Parent=AT1G01260; Name=AT1G01260.2; Note=basic helix-loop-helix (bHLH) DNA-binding superfamily protein; conf_class=2; Alias=JAM2, Jasmonate Associated MYC2 LIKE 2; computational_description=basic helix-loop-helix (bHLH) DNA-binding superfamily protein%3B FUNCTIONS IN: DNA binding%2C sequence-specific DNA binding transcription factor activity%3B INVOLVED IN: regulation of transcription%3B LOCATED IN: nucleus%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092)%2C Helix-loop-helix DNA-binding (InterPro:IPR011598)%3B BEST Arabidopsis thaliana protein match is: ABA-inducible BHLH-type transcription factor (TAIR:AT2G46510.1)%3B Has 3647 Blast hits to 3273 proteins in 223 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 174%3B Fungi - 93%3B Plants - 3336%3B Viruses - 0%3B Other Eukaryotes - 42 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11118137, PMID:12679534, PMID:12897250, PMID:14600211, PMID:15703057, PMID:16944199, PMID:17828375, PMID:18775970, PMID:21889054, PMID:22037706, PMID:23852442, PMID:24056034, PMID:24465948, locus:2035237; locus_type=protein_coding LOCN Exon COOR W/109595-111367 HITS AT1G01260.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01260.3 CDS ID=AT1G01260.3; Parent=AT1G01260; Name=AT1G01260.3; Note=basic helix-loop-helix (bHLH) DNA-binding superfamily protein; conf_class=4; Alias=JAM2, Jasmonate Associated MYC2 LIKE 2; computational_description=basic helix-loop-helix (bHLH) DNA-binding superfamily protein%3B FUNCTIONS IN: DNA binding%2C sequence-specific DNA binding transcription factor activity%3B INVOLVED IN: regulation of transcription%3B LOCATED IN: nucleus%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092)%2C Helix-loop-helix DNA-binding (InterPro:IPR011598)%3B BEST Arabidopsis thaliana protein match is: ABA-inducible BHLH-type transcription factor (TAIR:AT2G46510.1)%3B Has 3647 Blast hits to 3273 proteins in 223 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 174%3B Fungi - 93%3B Plants - 3336%3B Viruses - 0%3B Other Eukaryotes - 42 (source: NCBI BLink).; conf_rating=***; Dbxref=PMID:11118137, PMID:12679534, PMID:12897250, PMID:14600211, PMID:15703057, PMID:16944199, PMID:17828375, PMID:18775970, PMID:21889054, PMID:22037706, PMID:23852442, PMID:24056034, PMID:24465948, locus:2035237; locus_type=protein_coding LOCN Exon COOR W/109595-111367 HITS AT1G01270.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01270.1 tRNA ID=AT1G01270.1; Parent=AT1G01270; Note=tRNA-Gln; computational_description=tRNA-Gln (anticodon: CTG); Dbxref=PMID:8980477, PMID:23066098, PMID:8980477, locus:3691158; Name=AT1G01270.1; locus_type=pre_trna LOCN Exon COOR C/111890-111961 HITS AT1G01280.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01280.1 CDS ID=AT1G01280.1; Parent=AT1G01280; Name=AT1G01280.1; Note=cytochrome P450%2C family 703%2C subfamily A%2C polypeptide 2; curator_summary=member of CYP703A CYP703A2 is expressed specifically in anthers of land plants%2C catalyzing the in-chain hydroxylation at the C-7 position of medium-chain saturated fatty acids (lauric acid in-chain hydroxylase) which is involved in pollen development (sporopollenin synthesis).; conf_class=2; symbol=CYP703A2; Alias=CYP703; full_name=cytochrome P450%2C family 703%2C subfamily A%2C polypeptide 2; computational_description=cytochrome P450%2C family 703%2C subfamily A%2C polypeptide 2 (CYP703A2)%3B FUNCTIONS IN: oxidoreductase activity%2C acting on paired donors%2C with incorporation or reduction of molecular oxygen%2C NADH or NADPH as one donor%2C and incorporation of one atom of oxygen%2C oxygen binding%3B INVOLVED IN: medium-chain fatty acid metabolic process%2C pollen wall assembly%2C medium-chain fatty acid biosynthetic process%2C sporopollenin biosynthetic process%2C pollen exine formation%3B LOCATED IN: endomembrane system%3B EXPRESSED IN: 6 plant structures%3B EXPRESSED DURING: petal differentiation and expansion stage%3B CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128)%2C Cytochrome P450%2C conserved site (InterPro:IPR017972)%2C Cytochrome P450%2C E-class%2C group I (InterPro:IPR002401)%3B BEST Arabidopsis thaliana protein match is: Cytochrome P450 superfamily protein (TAIR:AT5G07990.1)%3B Has 29652 Blast hits to 29399 proteins in 1569 species: Archae - 44%3B Bacteria - 2451%3B Metazoa - 11172%3B Fungi - 6019%3B Plants - 9091%3B Viruses - 3%3B Other Eukaryotes - 872 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:12372144, PMID:15703057, PMID:16258015, PMID:16831835, PMID:16920875, PMID:17496121, PMID:18036205, PMID:18433503, PMID:19218397, PMID:19700560, PMID:20118226, PMID:20736450, PMID:21223384, PMID:21849515, PMID:23252839, locus:2035267; locus_type=protein_coding LOCN Exon COOR W/112290-113195,113279-113905 HITS AT1G01290.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01290.1 CDS ID=AT1G01290.1; Parent=AT1G01290; Name=AT1G01290.1; Note=cofactor of nitrate reductase and xanthine dehydrogenase 3; curator_summary=COFACTOR OF NITRATE REDUCTASE AND XANTHINE DEHYDROGENASE 3. Encodes a protein involved in molybdenum cofactor biosynthesis. Homologous to E.coli MoaC. Expression is low in all tissues examined%2C except in roots. Appears to have targeting signals for chloroplast or mitochondria; conf_class=2; symbol=CNX3; full_name=cofactor of nitrate reductase and xanthine dehydrogenase 3; computational_description=cofactor of nitrate reductase and xanthine dehydrogenase 3 (CNX3)%3B CONTAINS InterPro DOMAIN/s: Molybdopterin cofactor biosynthesis C (MoaC) domain (InterPro:IPR002820)%3B Has 5242 Blast hits to 5240 proteins in 1916 species: Archae - 213%3B Bacteria - 3669%3B Metazoa - 104%3B Fungi - 75%3B Plants - 45%3B Viruses - 0%3B Other Eukaryotes - 1136 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:7890743, PMID:14576160, PMID:15703057, PMID:18315867, PMID:18650403, PMID:20164445, locus:2035277; locus_type=protein_coding LOCN Exon COOR W/114299-114433,114619-115296 HITS AT1G01290.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01290.2 CDS ID=AT1G01290.2; Parent=AT1G01290; Name=AT1G01290.2; Note=cofactor of nitrate reductase and xanthine dehydrogenase 3; curator_summary=COFACTOR OF NITRATE REDUCTASE AND XANTHINE DEHYDROGENASE 3. Encodes a protein involved in molybdenum cofactor biosynthesis. Homologous to E.coli MoaC. Expression is low in all tissues examined%2C except in roots. Appears to have targeting signals for chloroplast or mitochondria; conf_class=2; symbol=CNX3; full_name=cofactor of nitrate reductase and xanthine dehydrogenase 3; computational_description=cofactor of nitrate reductase and xanthine dehydrogenase 3 (CNX3)%3B CONTAINS InterPro DOMAIN/s: Molybdopterin cofactor biosynthesis C (MoaC) domain (InterPro:IPR002820)%3B Has 5242 Blast hits to 5240 proteins in 1916 species: Archae - 213%3B Bacteria - 3669%3B Metazoa - 104%3B Fungi - 75%3B Plants - 45%3B Viruses - 0%3B Other Eukaryotes - 1136 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:7890743, PMID:14576160, PMID:15703057, PMID:18315867, PMID:18650403, PMID:20164445, locus:2035277; locus_type=protein_coding LOCN Exon COOR W/114299-114433,114619-115296 HITS AT1G01300.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01300.1 CDS ID=AT1G01300.1; Parent=AT1G01300; Name=AT1G01300.1; Note=Eukaryotic aspartyl protease family protein; conf_class=1; computational_description=Eukaryotic aspartyl protease family protein%3B FUNCTIONS IN: aspartic-type endopeptidase activity%3B INVOLVED IN: proteolysis%2C response to karrikin%3B LOCATED IN: membrane%2C plant-type cell wall%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Peptidase aspartic (InterPro:IPR021109)%2C Peptidase aspartic%2C catalytic (InterPro:IPR009007)%2C Peptidase A1 (InterPro:IPR001461)%3B BEST Arabidopsis thaliana protein match is: Eukaryotic aspartyl protease family protein (TAIR:AT3G61820.1)%3B Has 3898 Blast hits to 3871 proteins in 332 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 1165%3B Fungi - 579%3B Plants - 1953%3B Viruses - 0%3B Other Eukaryotes - 201 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:14697270, PMID:15295017, PMID:15695462, PMID:15531708, PMID:15703057, PMID:15755812, PMID:16287169, PMID:18650403, PMID:20351290, PMID:23289948, locus:2035297; locus_type=protein_coding LOCN Exon COOR W/117065-118522 HITS AT1G01305.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01305.1 CDS ID=AT1G01305.1; Parent=AT1G01305; Name=AT1G01305.1; Note=hypothetical protein; conf_class=1; computational_description=unknown protein%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: endomembrane system%3B Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12%3B Bacteria - 1396%3B Metazoa - 17338%3B Fungi - 3422%3B Plants - 5037%3B Viruses - 0%3B Other Eukaryotes - 2996 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:20032078, locus:4515102485; locus_type=protein_coding LOCN Exon COOR W/119429-119854 HITS AT1G01310.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01310.1 CDS ID=AT1G01310.1; Parent=AT1G01310; Name=AT1G01310.1; Note=CAP (Cysteine-rich secretory proteins%2C Antigen 5%2C and Pathogenesis-related 1 protein) superfamily protein; conf_class=1; computational_description=CAP (Cysteine-rich secretory proteins%2C Antigen 5%2C and Pathogenesis-related 1 protein) superfamily protein%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: extracellular region%3B EXPRESSED IN: 6 plant structures%3B EXPRESSED DURING: L mature pollen stage%2C M germinated pollen stage%2C 4 anthesis%2C petal differentiation and expansion stage%3B CONTAINS InterPro DOMAIN/s: Allergen V5/Tpx-1 related%2C conserved site (InterPro:IPR018244)%2C Allergen V5/Tpx-1 related (InterPro:IPR001283)%2C Ves allergen (InterPro:IPR002413)%2C SCP-like extracellular (InterPro:IPR014044)%3B BEST Arabidopsis thaliana protein match is: CAP (Cysteine-rich secretory proteins%2C Antigen 5%2C and Pathogenesis-related 1 protein) superfamily protein (TAIR:AT3G09590.1)%3B Has 2987 Blast hits to 2892 proteins in 368 species: Archae - 0%3B Bacteria - 64%3B Metazoa - 1591%3B Fungi - 333%3B Plants - 892%3B Viruses - 0%3B Other Eukaryotes - 107 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:15703057, PMID:18775970, locus:2035317; locus_type=protein_coding LOCN Exon COOR W/120221-120946 HITS AT1G01320.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01320.1 CDS ID=AT1G01320.1; Parent=AT1G01320; Name=AT1G01320.1; Note=Tetratricopeptide repeat (TPR)-like superfamily protein; conf_class=6; computational_description=Tetratricopeptide repeat (TPR)-like superfamily protein%3B FUNCTIONS IN: binding%3B LOCATED IN: cellular_component unknown%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 14 growth stages%3B CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990)%2C Tetratricopeptide repeat-containing (InterPro:IPR013026)%2C Tetratricopeptide repeat (InterPro:IPR019734)%3B BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT4G28080.1)%3B Has 12123 Blast hits to 4846 proteins in 494 species: Archae - 106%3B Bacteria - 3214%3B Metazoa - 4973%3B Fungi - 1823%3B Plants - 555%3B Viruses - 79%3B Other Eukaryotes - 1373 (source: NCBI BLink).; conf_rating=**; Dbxref=PMID:15642518, PMID:15632092, PMID:15703057, PMID:18650403, PMID:18775970, locus:2035327; locus_type=protein_coding LOCN Exon COOR C/121582-123501,123579-123669,123785-123897,123992-124123,124211-124394,124499-124632,124714-124818,124921-125046,125134-125226,125329-125655,125742-125843,125936-125998,126076-126589,126686-126840,126935-127453,127532-127573,127651-127782,127868-127935,128028-128312,128479-128551,128968-129060,129853-129914,130039-130099 HITS AT1G01320.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01320.2 CDS ID=AT1G01320.2; Parent=AT1G01320; Name=AT1G01320.2; Note=Tetratricopeptide repeat (TPR)-like superfamily protein; conf_class=4; computational_description=Tetratricopeptide repeat (TPR)-like superfamily protein%3B FUNCTIONS IN: binding%3B LOCATED IN: cellular_component unknown%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 14 growth stages%3B CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990)%2C Tetratricopeptide repeat-containing (InterPro:IPR013026)%2C Tetratricopeptide repeat (InterPro:IPR019734)%3B BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT4G28080.1)%3B Has 12123 Blast hits to 4846 proteins in 494 species: Archae - 106%3B Bacteria - 3214%3B Metazoa - 4973%3B Fungi - 1823%3B Plants - 555%3B Viruses - 79%3B Other Eukaryotes - 1373 (source: NCBI BLink).; conf_rating=***; Dbxref=PMID:15642518, PMID:15632092, PMID:15703057, PMID:18650403, PMID:18775970, locus:2035327; locus_type=protein_coding LOCN Exon COOR C/121582-123495,123579-123669,123785-123897,123992-124123,124211-124394,124499-124632,124714-124818,124921-125022,125134-125226,125329-125655,125742-125843,125936-125998,126076-126589,126686-126840,126935-127453,127532-127573,127651-127782,127868-127935,128028-128312,128479-128551,128968-129060,129853-129914,130039-130099 HITS AT1G01320.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01320.3 CDS ID=AT1G01320.3; Parent=AT1G01320; Name=AT1G01320.3; Note=Tetratricopeptide repeat (TPR)-like superfamily protein; computational_description=Tetratricopeptide repeat (TPR)-like superfamily protein%3B FUNCTIONS IN: binding%3B LOCATED IN: cellular_component unknown%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 14 growth stages%3B CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990)%2C Tetratricopeptide repeat-containing (InterPro:IPR013026)%2C Tetratricopeptide repeat (InterPro:IPR019734)%3B BEST Arabidopsis thaliana protein match is: Tetratricopeptide repeat (TPR)-like superfamily protein (TAIR:AT4G28080.1)%3B Has 12123 Blast hits to 4846 proteins in 494 species: Archae - 106%3B Bacteria - 3214%3B Metazoa - 4973%3B Fungi - 1823%3B Plants - 555%3B Viruses - 79%3B Other Eukaryotes - 1373 (source: NCBI BLink).; Dbxref=PMID:15642518, PMID:15632092, PMID:15703057, PMID:18650403, PMID:18775970, locus:2035327; locus_type=protein_coding LOCN Exon COOR C/121582-123501,123579-123669,123785-123897,123992-124123,124211-124394,124499-124632,124714-124818,124921-125022,125134-125226,125329-125655,125742-125843,125936-125998,126076-126589,126686-126840,126935-127453,127532-127573,127651-127782,127868-127935,128028-128312,128479-128551,128968-129060,129853-129914,130039-130099

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2016 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |