AtTOME: Arabidopsis Transcriptome iSect Tools ( Aug. 2, 2016 )


1. PrimerS :
Primer size - Opt: Min: Max:
Primer TM - Opt: Min: Max:
GC Content - Min: Max: Clamp:
Primer Zone - Left: Right: Format:     

Please paste your sequences:


  • 1. PrimerS : iSect primer (S) tool to design primers from user input sequences. For example:
    	>YourInput.fa
    	CTCGCTGGCCTGTTCAGGTGAATCTTAGTATCGTTTTGTGTCCATGTTGCCTCTACTTCG
    	CCTGCTTCTGGTGACTTGAATTCTCTCTTTGTTTTGGGCAGCTTCGGGAACCTTCCACAT
    	CCGAAGATGCTGAATTCGCTTCTATTTTGCGGACTCTCAAGGACAGTTTTGATAACGCAT
    	TCACTGCTATGATTTCCTTCCAGACGAAGAATTCCGAGCGCATATTCAGCACAGGTATAA
    
    
    

    hits since Aug 27, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
    © SIGnAL 2000-2016 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |