RiceGE: Genome Express Database ( Oct. 6, 2010 )

CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] 
CHRO chr04
EVAL 100.00
COOR C/4519393-4519413
NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a  osa-miR815b MIMAT0004059 Oryza sativa miR815b  osa-miR815c MIMAT0004060 Oryza sativa miR815c

CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] 
CHRO chr04
EVAL 100.00
COOR C/838818-838838
NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a  osa-miR815b MIMAT0004059 Oryza sativa miR815b  osa-miR815c MIMAT0004060 Oryza sativa miR815c

HITS Os04g02360[Seq] [RiceGE6]  [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1] 
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os04g02360.1 transposon protein, putative, CACTA, En/Spm sub-class LOCN Intron COOR W/837051-837193,837537-837767,838421-838600,838935-839123,839350-840900,840985-841096 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr03 EVAL 100.00 COOR C/36150586-36150606 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr03 EVAL 100.00 COOR W/28332251-28332271 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr03 EVAL 100.00 COOR C/25898950-25898970 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr03 EVAL 100.00 COOR C/25846525-25846545 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os03g45760[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os03g45760.1 expressed protein LOCN Intron COOR C/25844619-25844711,25844802-25844880,25844965-25845010,25845091-25845354,25845451-25845525,25845615-25845681,25845817-25845870,25846679-25846747,25846842-25847111 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr03 EVAL 100.00 COOR W/9709225-9709245 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os03g17460[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os03g17460.1 IN2-1 protein, putative, expressed LOCN 300-UTR5 COOR C/9707302-9707481,9707743-9707823,9707923-9708030,9708119-9708195,9708294-9708402,9708482-9708580,9708657-9708740,9708844-9708990 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr03 EVAL 100.00 COOR W/7737172-7737192 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os03g14240[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os03g14240.1 hypothetical protein LOCN Exon COOR W/7736292-7736299,7736991-7737075,7737157-7737213 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr03 EVAL 100.00 COOR C/5490068-5490088 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr03 EVAL 100.00 COOR C/3828994-3829014 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr03 EVAL 100.00 COOR W/1668544-1668564 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os03g03730[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os03g03730.1 regulatory protein, putative, expressed LOCN 300-UTR5 COOR C/1667197-1667676,1667941-1668264 HITS Os03g03740[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os03g03740.1 retrotransposon protein, putative, unclassified LOCN 300-UTR5 COOR W/1668800-1669141 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr03 EVAL 100.00 COOR C/1454893-1454913 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr02 EVAL 100.00 COOR W/26304091-26304111 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os02g43594[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os02g43594.3 MSP domain containing protein, putative, expressed LOCN Intron COOR C/26303689-26303823,26305801-26305827,26305912-26306049,26306156-26306271,26306420-26306501,26309704-26309774,26309880-26309934 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr02 EVAL 100.00 COOR W/25760937-25760957 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os02g42860[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os02g42860.1 DEAD-box ATP-dependent RNA helicase, putative, expressed LOCN 1000-Promotor COOR W/25761633-25761949,25762354-25762414,25763463-25763697,25763930-25764168,25765338-25765589,25765681-25765861,25766502-25766590,25766907-25766980,25767067-25767145 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr02 EVAL 100.00 COOR C/10058499-10058519 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr02 EVAL 100.00 COOR W/7307041-7307061 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr02 EVAL 100.00 COOR W/6824185-6824205 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr02 EVAL 100.00 COOR W/1112507-1112527 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os02g02880[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os02g02880.1 expressed protein LOCN 1000-Promotor COOR C/1106858-1106928,1109334-1109397,1109524-1109640,1109770-1109877,1110166-1110373,1110450-1110840,1110956-1111161,1111650-1111885 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr01 EVAL 100.00 COOR C/34918042-34918062 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os01g60360[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os01g60360.1 ubiquitin-conjugating enzyme, putative LOCN Intron COOR W/34916639-34916708,34917309-34917436,34917723-34917827,34918223-34918366 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr01 EVAL 100.00 COOR W/30204798-30204818 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr01 EVAL 100.00 COOR W/29675671-29675691 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr01 EVAL 100.00 COOR C/19010896-19010916 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os01g34480[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os01g34480.1 NAD dependent epimerase/dehydratase family protein, putative, expressed LOCN Intron COOR W/19008836-19008974,19009368-19009537,19010253-19010441,19011448-19011610,19012371-19012560,19012794-19012953 HITS Os01g34480[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os01g34480.2 NAD dependent epimerase/dehydratase family protein, putative, expressed LOCN Intron COOR W/19008836-19008974,19009368-19009537,19010253-19010441,19011448-19011610,19012371-19012564 HITS Os01g34480[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os01g34480.3 NAD dependent epimerase/dehydratase family protein, putative, expressed LOCN Intron COOR W/19008836-19008974,19009368-19009537,19010253-19010441,19011448-19011630 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr01 EVAL 100.00 COOR C/6946893-6946913 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr01 EVAL 100.00 COOR C/6109630-6109650 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os01g11360[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os01g11360.1 hypothetical protein LOCN Intron COOR C/6107958-6108058,6108512-6108643,6110068-6110317 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr01 EVAL 100.00 COOR C/5271724-5271744 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os01g10110[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os01g10110.1 cytokinin dehydrogenase precursor, putative, expressed LOCN Intron COOR C/5269835-5270153,5270605-5270870,5273319-5273785,5273877-5274522 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr01 EVAL 100.00 COOR C/5057838-5057858 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr01 EVAL 100.00 COOR C/3138110-3138130 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os01g06660[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os01g06660.1 thiamine pyrophosphate enzyme, C-terminal TPP binding domain containing protein, expressed LOCN Intron COOR C/3135502-3135672,3135759-3135947,3136037-3136154,3136398-3137048,3137146-3137309,3138598-3139098 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr01 EVAL 100.00 COOR W/2592150-2592170 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os01g05490[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os01g05490.1 triosephosphate isomerase, cytosolic, putative, expressed LOCN Intron COOR C/2589074-2589121,2589214-2589296,2589414-2589492,2589622-2589716,2590198-2590330,2590601-2590685,2591040-2591163,2591297-2591372,2592479-2592517 HITS Os01g05490[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os01g05490.2 triosephosphate isomerase, cytosolic, putative, expressed LOCN Intron COOR C/2589604-2589716,2590198-2590330,2590601-2590685,2591040-2591163,2591297-2591372,2592479-2592517 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr01 EVAL 100.00 COOR W/271721-271741 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os01g01520[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os01g01520.1 transferase family protein, putative, expressed LOCN Intron COOR C/269356-270333,273529-273957 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr01 EVAL 100.00 COOR C/27938-27958 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os01g01070[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os01g01070.2 expressed protein LOCN 1000-Promotor COOR W/28940-28976,29146-29228,29735-29806,29885-29963,30258-30325,30505-30606,31377-31466,31542-31616,31712-31744,31828-31908,32277-32330,32400-32471,32543-32617,32975-33124 HITS Os01g01070[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os01g01070.3 expressed protein LOCN 1000-Promotor COOR W/28940-28976,29146-29228,29735-29806,29885-29963,30258-30325,30505-30606,31377-31466,31542-31616,31712-31744,31828-31908,32277-32330,32400-32471,32543-32647 HITS Os01g01070[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os01g01070.1 expressed protein LOCN 1000-Promotor COOR W/28940-28976,29146-29228,29735-29806,29885-29963,30258-30331,30505-30606,31377-31466,31542-31616,31712-31744,31828-31908,32277-32330,32400-32471,32543-32617,32975-33124 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr04 EVAL 100.00 COOR W/4654995-4655015 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr04 EVAL 100.00 COOR W/14316655-14316675 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr04 EVAL 100.00 COOR C/14681956-14681976 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr04 EVAL 100.00 COOR C/14943565-14943585 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr04 EVAL 100.00 COOR W/15101388-15101408 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr04 EVAL 100.00 COOR W/16501782-16501802 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr04 EVAL 100.00 COOR C/20478170-20478190 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr04 EVAL 100.00 COOR C/20641037-20641057 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os04g34360[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os04g34360.1 serine/threonine-protein kinase receptor precursor, putative, expressed LOCN 300-UTR3 COOR W/20639161-20640858 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr04 EVAL 100.00 COOR C/23989359-23989379 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr04 EVAL 100.00 COOR W/24691865-24691885 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os04g41990[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os04g41990.1 autophagy-related protein 10, putative, expressed LOCN Intron COOR C/24691120-24691305,24691409-24691506,24691588-24691687,24692188-24692241,24692365-24692523 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr04 EVAL 100.00 COOR C/26890400-26890420 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr05 EVAL 100.00 COOR W/2890765-2890785 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr05 EVAL 100.00 COOR C/4892070-4892090 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr05 EVAL 100.00 COOR W/13176335-13176355 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr05 EVAL 100.00 COOR W/13314196-13314216 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os05g23398[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os05g23398.1 expressed protein LOCN 1000-Promotor COOR W/13314835-13315143 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr05 EVAL 100.00 COOR W/14934849-14934869 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os05g25770[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os05g25770.1 OsWRKY45 - Superfamily of TFs having WRKY and zinc finger domains, expressed LOCN Intron COOR W/14934236-14934543,14935137-14935241,14935343-14935910 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr05 EVAL 100.00 COOR C/16067638-16067658 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr05 EVAL 100.00 COOR W/17857471-17857491 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os05g30860[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os05g30860.1 expressed protein LOCN 300-UTR5 COOR C/17855521-17855916,17856012-17856113,17857148-17857252 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr05 EVAL 100.00 COOR W/25125376-25125396 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os05g43290[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os05g43290.1 hypothetical protein LOCN 300-UTR5 COOR C/25124216-25124459,25124497-25124639,25125094-25125156 HITS Os05g43300[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os05g43300.1 expressed protein LOCN 1000-Promotor COOR W/25126096-25126186,25126835-25127058,25127166-25127227,25127952-25128173,25128473-25128602,25129106-25129431,25129643-25129784,25129902-25130147 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr05 EVAL 100.00 COOR W/29684045-29684065 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr06 EVAL 100.00 COOR W/5273522-5273542 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr06 EVAL 100.00 COOR W/5444175-5444195 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr06 EVAL 100.00 COOR C/7959140-7959160 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr06 EVAL 100.00 COOR C/18822061-18822081 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os06g32340[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os06g32340.1 transposon protein, putative, CACTA, En/Spm sub-class LOCN Intron COOR W/18821333-18821410,18823425-18824207,18824343-18826727 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr06 EVAL 100.00 COOR C/21561798-21561818 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr06 EVAL 100.00 COOR W/23887615-23887635 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr06 EVAL 100.00 COOR C/29396574-29396594 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr07 EVAL 100.00 COOR W/343968-343988 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr07 EVAL 100.00 COOR C/4653420-4653440 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os07g08950[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os07g08950.1 FAD-linked oxidoreductase protein, putative, expressed LOCN Intron COOR W/4651926-4652004,4652827-4653185,4653610-4653711,4654168-4654215,4654377-4654447,4654720-4654838,4655176-4655271,4655376-4655485,4655583-4655663,4655973-4656073,4656512-4656620,4656820-4656925,4656989-4657074,4657173-4657298,4657665-4657751 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr07 EVAL 100.00 COOR W/5156439-5156459 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr07 EVAL 100.00 COOR C/5425889-5425909 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os07g10110[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os07g10110.1 expressed protein LOCN 1000-Promotor COOR C/5418095-5418257,5420250-5420383,5420457-5420645,5421162-5421674,5422664-5423705,5424132-5424229,5425073-5425300 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr07 EVAL 100.00 COOR C/7716135-7716155 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os07g13460[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os07g13460.1 expressed protein LOCN 1000-Promotor COOR W/7716786-7717113,7717265-7717395,7718535-7718596,7718856-7718898,7719045-7719080,7720584-7720670,7720770-7721705,7722134-7722226,7722311-7722664 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr07 EVAL 100.00 COOR W/19916693-19916713 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr07 EVAL 100.00 COOR C/25472052-25472072 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr07 EVAL 100.00 COOR C/27064192-27064212 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr08 EVAL 100.00 COOR W/13943314-13943334 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os08g23140[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os08g23140.2 expressed protein LOCN Intron COOR W/13941287-13941335,13941413-13941499,13941597-13941730,13943811-13943869,13943937-13943991,13944105-13944131,13945743-13945776,13946007-13946050 HITS Os08g23140[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os08g23140.1 expressed protein LOCN Intron COOR W/13941287-13941335,13941413-13941499,13941597-13941730,13943811-13943869,13943937-13943991,13944105-13944131,13945743-13945776,13946978-13947021,13947084-13947197,13947299-13947346,13947429-13947548,13947660-13947740 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr08 EVAL 100.00 COOR C/27599138-27599158 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr09 EVAL 100.00 COOR C/7309671-7309691 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr09 EVAL 100.00 COOR W/11741402-11741422 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr09 EVAL 100.00 COOR C/15909061-15909081 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os09g26320[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os09g26320.1 hypro1, putative LOCN 300-UTR3 COOR C/15909194-15909377,15909446-15910056 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr10 EVAL 100.00 COOR W/5938761-5938781 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr10 EVAL 100.00 COOR C/6277058-6277078 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os10g11280[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os10g11280.1 retrotransposon protein, putative, unclassified LOCN Exon COOR C/6274253-6274890,6275005-6275190,6275641-6276233,6277041-6277123,6277358-6277712,6277935-6278241,6278437-6278557 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr10 EVAL 100.00 COOR W/6861383-6861403 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr10 EVAL 100.00 COOR C/8222486-8222506 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr10 EVAL 100.00 COOR C/14627238-14627258 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr10 EVAL 100.00 COOR W/22577759-22577779 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os10g42110[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os10g42110.1 protein kinase family protein, putative, expressed LOCN 1000-Promotor COOR W/22578663-22578753,22578865-22579136,22579233-22579368,22579681-22579814,22580003-22580108,22580282-22580367,22580757-22580945,22581033-22581191,22581536-22581649,22581936-22582187 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr10 EVAL 100.00 COOR C/22638913-22638933 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr10 EVAL 100.00 COOR C/22638968-22638988 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr11 EVAL 100.00 COOR W/3921019-3921039 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr11 EVAL 100.00 COOR W/8820040-8820060 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os11g15570[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os11g15570.1 Ser/Thr protein phosphatase family protein, putative, expressed LOCN 1000-Promotor COOR W/8820974-8822233 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr11 EVAL 100.00 COOR W/13762787-13762807 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr11 EVAL 100.00 COOR C/14963867-14963887 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr11 EVAL 100.00 COOR C/24741770-24741790 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr12 EVAL 100.00 COOR C/1328932-1328952 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr12 EVAL 100.00 COOR W/2184298-2184318 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr12 EVAL 100.00 COOR C/7986638-7986658 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS Os12g14070[Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL Os12g14070.1 DnaK family protein, putative, expressed LOCN Intron COOR W/7983647-7984177,7985024-7985276,7985915-7985994,7986813-7986955,7987045-7987143,7987249-7987438,7987684-7988082,7988539-7988940 CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chr12 EVAL 100.00 COOR C/19073868-19073888 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c CLON AAGGGGAUUGAGGAGAUUGGG[Seq] [About miRBase microRNA] [Structure] TYPE microRNA CHRO chrSy EVAL 100.00 COOR C/117019-117039 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2010 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |