RiceGE: Genome Express Database ( Jan. 16, 2018 )

CLON CATGTATCACATCGATGTAAT[About LongSAGE] [SAGE Libraries] [Tag Expression] 
CHRO chr01
EVAL 100.00
COOR W/20310-20330

HITS Os01g01050[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TITL R3H domain containing protein, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m42816 (update, updateIDs: 123099, (gene: 12001.t00005, model: 12001.m42816)); PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06752 (
LOCN Intron
COOR W/20034-20083,20374-20649,20764-20835,21294-21379,22247-22321,22685-23193
HITS Os01g01050[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TITL R3H domain containing protein, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m42816 (update, updateIDs: 123099, (gene: 12001.t00005, model: 12001.m42816)); PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06752 (
LOCN Intron
COOR W/20060-20083,20417-20649,20764-20835,21294-21379,22247-22321,22685-23193

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |