RiceGE: Genome Express Database ( Jan. 16, 2018 )


CLON CATGGCATCACTTTCACCTAT[About LongSAGE] [SAGE Libraries] [Tag Expression] 
TYPE LongSAGE Tags
CHRO chr01
EVAL 100.00
COOR W/31031-31051

HITS Os01g01070[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
TITL expressed protein (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12001.t00007 = 12001.m42818); (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12001.m06754.) ;
LOCN 300-UTR3
COOR W/26742-26778,26948-27030,27537-27608,27687-27765,28060-28127,28307-28408,29179-29268,29344-29418,29514-29546,29630-29710,30079-30132,30202-30273,30345-30419,30777-30926
HITS Os01g01070[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
TITL expressed protein (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12001.t00007 = 12001.m42818); (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12001.m06754.) ;
LOCN 300-UTR3
COOR W/26742-26778,26948-27030,27537-27608,27687-27765,28060-28133,28307-28408,29179-29268,29344-29418,29514-29546,29630-29710,30079-30132,30202-30273,30345-30419,30777-30926



hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |