RiceGE: Genome Express Database ( Jan. 16, 2018 )

CLON CATGCTCTAATTCTGATATGT[About LongSAGE] [SAGE Libraries] [Tag Expression] 
CHRO chr01
EVAL 100.00
COOR W/25141-25161

HITS Os01g01060[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TITL 40S ribosomal protein S5, putative, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06753 (update, updateIDs: 5, (gene: 12001.t00006, model: 12001.m06753)); (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12001.t00006 = 120
LOCN Intron
COOR W/24023-24088,24172-24443,24892-25095,25167-25221
HITS Os01g01060[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TITL 40S ribosomal protein S5, putative, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06753 (update, updateIDs: 5, (gene: 12001.t00006, model: 12001.m06753)); (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12001.t00006 = 120
LOCN Intron
COOR W/24023-24094,24172-24443,24892-25095,25167-25221

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |