RiceGE: Genome Express Database ( Jan. 16, 2018 )

CLON CATGACGAAGGATTCAGAGGA[About LongSAGE] [SAGE Libraries] [Tag Expression] 
CHRO chr01
EVAL 100.00
COOR W/80588-80608

HITS Os01g01160[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TITL chaperone protein dnaJ 20, chloroplast precursor, putative, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06763 (update, updateIDs: 123112, (gene: 12001.t00016, model: 12001.m06763)); (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12001.m06763.) ;
COOR W/79309-79734,80520-80666

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |