RiceGE: Genome Express Database ( Jan. 16, 2018 )

CLON GATCTTGATTTGGGGTTGTG[About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 CHRO chr01 EVAL 1 COOR W/75061-75080 NOTE 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |