RiceGE: Genome Express Database ( Jan. 16, 2018 )


CLON GATCTATCCAGCTTACCTGG[About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 CHRO chr01 EVAL 1 COOR W/85409-85428 NOTE 0 0 0 0 0 137 0 0 7 0 0 11 0 0 0 0 0 0 HITS Os01g01170[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL expressed protein (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12001.m06764.) ; LOCN 300-UTR3 COOR W/82181-82402,82539-82632,82737-82888,83014-83101,83201-84483,85093-85200,85302-85385

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |