RiceGE: Genome Express Database ( Jan. 16, 2018 )

CLON GATCGATGTTGTCATTGTTT[About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 CHRO chr01 EVAL 1 COOR W/7395-7414 NOTE 0 0 8 0 0 0 31 0 22 0 0 3 0 37 0 7 0 0 HITS Os01g01010[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL TBC domain containing protein, expressed (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12001.t00001 = 12001.m42814); (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12001.m06748.) ; LOCN 300-UTR3 COOR W/251-418,1159-1257,2259-2362,3938-4746,4830-4952,5034-5122,5210-5410,6012-6113,6906-6989,7034-7046,7306-7364

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |