RiceGE: Genome Express Database ( Jan. 16, 2018 )

CLON GATCCTCTTCTTGACAGACG[About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 CHRO chr01 EVAL 1 COOR W/59864-59883 NOTE 0 0 0 0 0 0 0 0 0 2 0 0 0 8 0 6 0 0 HITS Os01g01120[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL E-1 enzyme, putative, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m97447 (update, updateIDs: 9, (gene: 12001.t00012, model: 12001.m97447)); PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06759 (updat LOCN Exon COOR W/58906-59097,59187-59707,59798-59916,60050-60147

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |