RiceGE: Genome Express Database ( Jan. 16, 2018 )

CLON GATCCAGGTGTTCCCATTGC[About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 CHRO chr01 EVAL 1 COOR C/14517-14536 NOTE 0 0 0 0 14 0 0 0 0 0 5 0 0 0 0 0 0 0 HITS Os01g01040[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL expressed protein (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00004 = 12001.m150453); (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00004 = 12001.m150452); (PASA (rice_osa1r5_gm LOCN Exon COOR W/13401-13778,14185-14276,14360-15060,15303-15373,15770-15859,15944-16123,16333-16395 HITS Os01g01040[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL expressed protein (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00004 = 12001.m150453); (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00004 = 12001.m150452); (PASA (rice_osa1r5_gm LOCN Exon COOR W/13401-13778,14185-14276,14360-15074

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |