RiceGE: Genome Express Database ( Jan. 16, 2018 )

CLON GATCCAGCACAATCTGATTG[About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 CHRO chr01 EVAL 1 COOR W/61221-61240 NOTE 0 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 0 0 HITS Os01g01130[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL snurportin-1, putative, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06760 (update, updateIDs: 123108, (gene: 12001.t00013, model: 12001.m06760)); (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12001.m06760.) ; LOCN Exon COOR C/60472-60585,60679-60822,61141-61233,61467-61581,61704-61954,62050-62233,62430-62464

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |