RiceGE: Genome Express Database ( Jan. 16, 2018 )

CLON GATCATGGAGCTCGCCATGG[About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 CHRO chr01 EVAL 1 COOR W/32541-32560 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 HITS Os01g01080[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL sphingosine-1-phosphate lyase, putative, expressed (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00008 = 12001.m150454); (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00008 = 12001.m100000); PASA (rice_osa1r5_gma LOCN Exon COOR W/32545-32741,32829-32874,33319-33470,33620-33679,34396-34620,34694-34835,35078-35128,35236-35327,36121-36247,36355-36370,36741-36848,36937-36991,37258-37404,37505-37583,37687-37809

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |