RiceGE: Genome Express Database ( Jan. 16, 2018 )

CLON GATCAGGGTATCCAGGAAGC[About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 CHRO chr01 EVAL 1 COOR W/73628-73647 NOTE 0 0 0 0 0 0 0 0 16 0 0 0 0 0 0 0 0 0 HITS Os01g01150[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL nucleic acid binding protein, putative, expressed (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00015 = 12001.m150455); (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00015 = 12001.m100000); PASA (rice_osa1r5_gma LOCN Exon COOR W/69705-70737,71270-71783,72421-73810

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |