RiceGE: Genome Express Database ( Jan. 16, 2018 )


CODE Os01g01080 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr01
TITL sphingosine-1-phosphate lyase, putative, expressed (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00008 = 12001.m150454); (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00008 = 12001.m100000); PASA (rice_osa1r5_gma
COOR W/32545-32741,32829-32874,33319-33470,33620-33679,34396-34620,34694-34835,35078-35128,35236-35327,36121-36247,36355-36370,36741-36848,36937-36991,37258-37404,37505-37583,37687-37809

HITS CI589595 [GenBank] 
TYPE Rice EST ctgs
EVAL e-176
LOCN Exon
COOR W/32383-32736,32837-32864
HITS CR288572 [GenBank] 
TYPE Rice EST ctgs
EVAL e-111
LOCN Exon
COOR W/32401-32620,32711-32741,32829-32872,33317-33470,33620-33679,34396-34600
NOTE CI582459 
HITS CB667995 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN Exon
COOR W/32416-32743,32831-32872,33317-33470,33620-33679,34396-34621,34695-34740
NOTE CB676749 BX898999 CI572033 CI638456 CI657255 CI755744 CI762738 CI770635 CI776382 CB638640 CI593753 CI624324 CI566844 
HITS J100082C01 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 99.95
LOCN Exon
COOR W/32425-32741,32829-32874,33319-33470,33620-33679,34396-34620,34694-34835,35078-35128,35236-35327,36121-36247,36355-36370,36741-36848,36937-36991,37258-37404,37505-37583,37687-37938
HITS CB674329 [GenBank] 
TYPE Rice EST ctgs
EVAL e-124
LOCN Exon
COOR W/32436-32627,32691-32743,32831-32872,33317-33470,33620-33679,34396-34621,34695-34742
NOTE CI610404 CI655909 C19281 CI574032 CI293280 AW154988 CI617341 CI625296 CI742010 AW154973 CV152417 
HITS GATCATGGAGCTCGCCATGG [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/32541-32560 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 HITS GATCATGGAGCTCGCCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/32541-32557 NOTE 0 0 0 0 0 0 0 0 0 3 0 0 0 0 3 0 0 0 HITS EU152208 [GenBank] TYPE Community cDNA EVAL 99.22 LOCN Exon COOR W/32544-32741,32829-32874,33319-33470,33620-33679,34396-34620,34694-34835,35078-35128,35236-35327,36121-36247,36355-36370,36741-36848,36937-37404,37505-37583,37687-37970 HITS AY972084 [GenBank] TYPE Community cDNA EVAL 100.00 LOCN Exon COOR W/32545-32741,32829-32874,33319-33470,33620-33679,34396-34620,34694-34835,35078-35128,35236-35327,36121-36247,36355-36370,36741-36848,36937-36991,37258-37404,37505-37583,37687-37809 HITS PFG_2D-10116.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Exon COOR W/32561-33247 NOTE D02507 2772 Dongjin T-DNA Left Border HITS OSIGCSA015E01 [GenBank] [About RiCD] [RiCD Search] [Order from NCGR, China] TYPE RiCD FL-cDNA EVAL 75.15 LOCN Exon COOR W/32687-33060,33054-33203 NOTE CT828902 HITS At1g27980 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL e-176 LOCN Exon COOR W/32827-32843,33316-33369,33473-33524,34397-34471,34472-34483,34620-34696,34834-34868,35218-35255,36122-36163,36731-36770,36778-36801,36849-36885,37259-37306,37311-37325,37404-37445,37687-37724,37796-37831 HITS PFG_2C-30280.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 6e-24 LOCN Intron COOR W/33231-33336 NOTE C13286 2717 Dongjin T-DNA Left Border HITS CB671873 [GenBank] TYPE Rice EST ctgs EVAL e-124 LOCN Exon COOR W/33378-33470,33620-33679,34396-34621,34695-34835,35078-35126,35234-35326,36120-36236 HITS GATCGTTTATCACTTGGTTG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR C/33396-33415 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 0 0 HITS GATCTCGAAACACTGAA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/33412-33428 NOTE 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 0 0 0 HITS M0061850 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 0.0 LOCN Intron COOR C/33414-33803 HITS M0026841 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 0.0 LOCN Exon COOR W/34608-35122 HITS M0028179 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 3e-121 LOCN Intron COOR W/34657-34916 HITS M0124003 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 8e-152 LOCN Exon COOR W/34728-35027 HITS GATCTCTGCCTTGGTGGATT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/35281-35300 NOTE 27 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 HITS GATCTCTGCCTTGGTGG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/35281-35297 NOTE 19 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 HITS CB667996 [GenBank] TYPE Rice EST ctgs EVAL e-160 LOCN Exon COOR C/36120-36247,36740-36850,36939-36990,37257-37404,37505-37583,37687-37973 NOTE CB671874 CB674330 BX898904 CF195681 CF195750 CF195823 HITS PFG_K-01409.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 3e-78 LOCN Exon COOR W/36146-36293 NOTE E02525 2715 Kitaake T-DNA Right Border HITS PFG_K-01409.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 7e-76 LOCN Exon COOR W/36146-36292 NOTE E02525 2715 Kitaake T-DNA Right Border HITS Os-21356-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 100.00 LOCN Exon COOR W/36742-36848,36937-36991,37258-37404,37505-37583,37687-37749 HITS CR280490 [GenBank] TYPE Rice EST ctgs EVAL 1e-71 LOCN Exon COOR W/36936-36985,37257-37405,37893-37987 NOTE CR280544 CI065706 CI088435 CI075509 CI067912 CI090568 CI085350 CI042254 CI102234 CI093329 CI103487 CI087668 CI015509 CI298895 CB638641 CI035591 CI035225 CI069384 CI070292 CI072547 CI074869 CI090640 CI133146 CI222962 EE591040 CI317426 CI044116 CI335495 CI001860 CI392775 CI538696 CI043605 CI391186 CI552828 CI554419 CI382342 CI324581 CI546006 CI560777 CR288663 BQ908807 DQ883945 HITS M0072621 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 7e-168 LOCN Exon COOR C/36954-37282 HITS BM421171 [GenBank] TYPE Rice EST ctgs EVAL 1e-88 LOCN Exon COOR W/37502-37596,37692-38004 NOTE DQ883961 BI806200 D43044 CI324989 HITS OSIGCSA021E03 [GenBank] [About RiCD] [RiCD Search] [Order from NCGR, China] TYPE RiCD FL-cDNA EVAL 59.74 LOCN Exon COOR W/37502-37583,37687-37979 NOTE CT833495 HITS DQ883961 [GenBank] TYPE Rice Markers EVAL 5e-17 LOCN Exon COOR W/37502-37545 HITS GATCCTTCAGGAATTCCTCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR C/37544-37563 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 0 0 HITS GATCCTTCAGGAATTCC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR C/37547-37563 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 HITS GATCTGAAAGATTCAGTGGA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/37560-37579 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 0 HITS GATCTGAAAGATTCAGT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/37560-37576 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 8 0 0 HITS CATGCCTCTGTCCGGCATCTT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN Exon COOR C/37747-37767 HITS PFG_2C-00059.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Exon COOR W/37775-38554 NOTE C11154 2717 Dongjin T-DNA Left Border HITS CATGATGATAATACTAGTACA [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR C/37860-37880 HITS CATGTACTCACCATAGAACCA [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR W/37883-37903 HITS CATGCAGCTATATTTTATTAT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR C/37943-37963 HITS CATGCAGTTCAGTTCATTTCA [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR W/37960-37980 CODE Os01g01080 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene CHRO chr01 TITL sphingosine-1-phosphate lyase, putative, expressed (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00008 = 12001.m150454); (PASA (rice_osa1r5_gmapsim4_05232006) ALT-SPLICE: Added alt splice isoform to 12001.t00008 = 12001.m100000); PASA (rice_osa1r5_gma COOR W/33678-33679,34396-34620,34694-34835,35078-35128,35236-35327,36121-36247,36355-36370,36741-36848,36937-36991,37258-37404,37505-37583,37687-37809 HITS CB671873 [GenBank] TYPE Rice EST ctgs EVAL e-124 LOCN Exon COOR W/33378-33470,33620-33679,34396-34621,34695-34835,35078-35126,35234-35326,36120-36236 HITS GATCGTTTATCACTTGGTTG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN 300-UTR5 COOR C/33396-33415 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 0 0 HITS GATCTCGAAACACTGAA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN 300-UTR5 COOR W/33412-33428 NOTE 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 0 0 0 HITS M0061850 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 0.0 LOCN Intron COOR C/33414-33803 HITS M0026841 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 0.0 LOCN Exon COOR W/34608-35122 HITS M0028179 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 3e-121 LOCN Intron COOR W/34657-34916 HITS M0124003 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 8e-152 LOCN Exon COOR W/34728-35027 HITS GATCTCTGCCTTGGTGGATT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/35281-35300 NOTE 27 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 HITS GATCTCTGCCTTGGTGG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/35281-35297 NOTE 19 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 HITS CB667996 [GenBank] TYPE Rice EST ctgs EVAL e-160 LOCN Exon COOR C/36120-36247,36740-36850,36939-36990,37257-37404,37505-37583,37687-37973 NOTE CB671874 CB674330 BX898904 CF195681 CF195750 CF195823 HITS PFG_K-01409.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 3e-78 LOCN Exon COOR W/36146-36293 NOTE E02525 2715 Kitaake T-DNA Right Border HITS PFG_K-01409.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 7e-76 LOCN Exon COOR W/36146-36292 NOTE E02525 2715 Kitaake T-DNA Right Border HITS Os-21356-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 100.00 LOCN Exon COOR W/36742-36848,36937-36991,37258-37404,37505-37583,37687-37749 HITS CR280490 [GenBank] TYPE Rice EST ctgs EVAL 1e-71 LOCN Exon COOR W/36936-36985,37257-37405,37893-37987 NOTE CR280544 CI065706 CI088435 CI075509 CI067912 CI090568 CI085350 CI042254 CI102234 CI093329 CI103487 CI087668 CI015509 CI298895 CB638641 CI035591 CI035225 CI069384 CI070292 CI072547 CI074869 CI090640 CI133146 CI222962 EE591040 CI317426 CI044116 CI335495 CI001860 CI392775 CI538696 CI043605 CI391186 CI552828 CI554419 CI382342 CI324581 CI546006 CI560777 CR288663 BQ908807 DQ883945 HITS M0072621 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 7e-168 LOCN Exon COOR C/36954-37282 HITS BM421171 [GenBank] TYPE Rice EST ctgs EVAL 1e-88 LOCN Exon COOR W/37502-37596,37692-38004 NOTE DQ883961 BI806200 D43044 CI324989 HITS OSIGCSA021E03 [GenBank] [About RiCD] [RiCD Search] [Order from NCGR, China] TYPE RiCD FL-cDNA EVAL 59.74 LOCN Exon COOR W/37502-37583,37687-37979 NOTE CT833495 HITS DQ883961 [GenBank] TYPE Rice Markers EVAL 5e-17 LOCN Exon COOR W/37502-37545 HITS GATCCTTCAGGAATTCCTCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR C/37544-37563 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 0 0 0 HITS GATCCTTCAGGAATTCC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR C/37547-37563 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 HITS GATCTGAAAGATTCAGTGGA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/37560-37579 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 0 HITS GATCTGAAAGATTCAGT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/37560-37576 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 8 0 0 HITS CATGCCTCTGTCCGGCATCTT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN Exon COOR C/37747-37767 HITS PFG_2C-00059.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Exon COOR W/37775-38554 NOTE C11154 2717 Dongjin T-DNA Left Border HITS CATGATGATAATACTAGTACA [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR C/37860-37880 HITS CATGTACTCACCATAGAACCA [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR W/37883-37903 HITS CATGCAGCTATATTTTATTAT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR C/37943-37963 HITS CATGCAGTTCAGTTCATTTCA [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN 300-UTR3 COOR W/37960-37980

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |