RiceGE: Genome Express Database ( Oct. 6, 2010 )


CODE Os01g01070 [Seq] [RiceGE6]  [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1] 
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene CHRO chr01 TITL Os01g01070.2 expressed protein COOR W/28940-28976,29146-29228,29735-29806,29885-29963,30258-30325,30505-30606,31377-31466,31542-31616,31712-31744,31828-31908,32277-32330,32400-32471,32543-32617,32975-33124 HITS AAGGGGAUUGAGGAGAUUGGG [Seq] [About miRBase microRNA] [Structure] TYPE microRNA EVAL 100.00 LOCN 1000-Promotor COOR C/27938-27958 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS PFG_3A-09045.L [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN 1000-Promotor COOR W/28013-28700 NOTE A20594 2715 Dongjin T-DNA Left Border HITS PFG_2D-30058.R [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN 1000-Promotor COOR W/28388-28712 NOTE D06042 2772 Dongjin T-DNA Right Border HITS smRNA73350_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR C/28529-28552 HITS PFG_3A-09614.R [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN 300-UTR5 COOR W/28799-29440 NOTE A21386 2715 Dongjin T-DNA Right Border HITS J033111I18 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 99.80 LOCN Exon COOR W/28818-28976,29146-29228,29735-29806,29885-29963,30258-30325,30505-30606,31377-31466,31542-31616,31712-31744,31828-31908,32277-32330,32400-32471,32543-32617,32975-33453 HITS BT060997 [GenBank] TYPE Maize cDNA EVAL 6e-80 LOCN Exon COOR W/28937-28950,29181-29196,29756-29775,29885-29911,30259-30270,30284-30303,30502-30538,31380-31409,31492-31505,31506-31524,31542-31566,31617-31647,31828-31856,31926-31942,32274-32293,32332-32350,32540-32565,32975-33005,33054-33072,33076-33094 HITS BT066602 [GenBank] TYPE Maize cDNA EVAL 2e-76 LOCN Exon COOR W/28983-28998,29181-29196,29756-29775,29885-29911,30259-30270,30284-30303,30502-30538,31380-31409,31492-31505,31506-31524,31542-31566,31617-31647,31828-31856,31926-31942,32274-32293,32332-32350,32540-32565,32975-33005,33054-33080 HITS AGATGATGTGGCTGTTT [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Intron COOR C/29528-29544 NOTE 0 0 0 1 0 0 HITS GAGATGATGTGGCTGTT [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Intron COOR C/29529-29545 NOTE 5 0 0 0 0 0 HITS CGAGATGATGTGGCTGT [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Intron COOR C/29530-29546 NOTE 2 0 0 0 0 0 HITS GTTTTCACAGGTTTTCA [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Intron COOR C/30874-30890 NOTE 0 0 0 0 0 2 HITS PFG_1C-03852.R [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR C/31097-31634 NOTE B03027 2707 Hwayoung T-DNA Right Border HITS RMD_03Z11CT33-3 [Seq] [About RMD] [Trait] [iSect Primer] [Request] TYPE RMD T-DNA EVAL 0.0 LOCN 300-UTR3 COOR C/32740-33304 HITS RMD_ATL-03Z11CT33_LBT2 [Seq] [About RMD] [Trait] [iSect Primer] [Request] TYPE RMD T-DNA EVAL 0.0 LOCN 300-UTR3 COOR C/32740-33304 HITS PFG_3A-05546.L [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR W/32797-33364 NOTE A15657 2715 Dongjin T-DNA Left Border HITS ND2009_0_701_1A [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33369 NOTE FT907814 HITS ND2019_0_701_1A [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33369 NOTE FT907848 HITS ND2047_0_702_1A [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33369 NOTE FT907999 HITS ND2048_0_701_1A [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33369 NOTE FT908006 HITS ND2049_0_702_1A [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33369 NOTE FT908011 HITS ND2049_0_703_1A [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33369 NOTE FT908012 HITS ND2053_0_702_1A [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33599 NOTE AG023766 HITS T08420T [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33561 NOTE FT919116 HITS T08501T [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33369 NOTE FT919134 HITS T08507T [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL e-163 LOCN Exon COOR W/33050-33339 NOTE FT919137 HITS T08508T [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 3e-67 LOCN Exon COOR W/33050-33178 NOTE FT919138 HITS T08528T [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33561 NOTE FT919144 HITS PFG_2C-30136.R [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Exon COOR W/33088-33719 NOTE C13113 2717 Dongjin T-DNA Right Border CODE Os01g01070 [Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene CHRO chr01 TITL Os01g01070.3 expressed protein COOR W/28940-28976,29146-29228,29735-29806,29885-29963,30258-30325,30505-30606,31377-31466,31542-31616,31712-31744,31828-31908,32277-32330,32400-32471,32543-32647 HITS AAGGGGAUUGAGGAGAUUGGG [Seq] [About miRBase microRNA] [Structure] TYPE microRNA EVAL 100.00 LOCN 1000-Promotor COOR C/27938-27958 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS PFG_3A-09045.L [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN 1000-Promotor COOR W/28013-28700 NOTE A20594 2715 Dongjin T-DNA Left Border HITS PFG_2D-30058.R [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN 1000-Promotor COOR W/28388-28712 NOTE D06042 2772 Dongjin T-DNA Right Border HITS smRNA73350_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR C/28529-28552 HITS PFG_3A-09614.R [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN 300-UTR5 COOR W/28799-29440 NOTE A21386 2715 Dongjin T-DNA Right Border HITS J033111I18 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 99.80 LOCN Exon COOR W/28818-28976,29146-29228,29735-29806,29885-29963,30258-30325,30505-30606,31377-31466,31542-31616,31712-31744,31828-31908,32277-32330,32400-32471,32543-32617,32975-33453 HITS BT060997 [GenBank] TYPE Maize cDNA EVAL 6e-80 LOCN Exon COOR W/28937-28950,29181-29196,29756-29775,29885-29911,30259-30270,30284-30303,30502-30538,31380-31409,31492-31505,31506-31524,31542-31566,31617-31647,31828-31856,31926-31942,32274-32293,32332-32350,32540-32565,32975-33005,33054-33072,33076-33094 HITS BT066602 [GenBank] TYPE Maize cDNA EVAL 2e-76 LOCN Exon COOR W/28983-28998,29181-29196,29756-29775,29885-29911,30259-30270,30284-30303,30502-30538,31380-31409,31492-31505,31506-31524,31542-31566,31617-31647,31828-31856,31926-31942,32274-32293,32332-32350,32540-32565,32975-33005,33054-33080 HITS AGATGATGTGGCTGTTT [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Intron COOR C/29528-29544 NOTE 0 0 0 1 0 0 HITS GAGATGATGTGGCTGTT [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Intron COOR C/29529-29545 NOTE 5 0 0 0 0 0 HITS CGAGATGATGTGGCTGT [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Intron COOR C/29530-29546 NOTE 2 0 0 0 0 0 HITS GTTTTCACAGGTTTTCA [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Intron COOR C/30874-30890 NOTE 0 0 0 0 0 2 HITS PFG_1C-03852.R [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR C/31097-31634 NOTE B03027 2707 Hwayoung T-DNA Right Border HITS PFG_3A-05546.L [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN 300-UTR3 COOR W/32797-33364 NOTE A15657 2715 Dongjin T-DNA Left Border CODE Os01g01070 [Seq] [RiceGE6] [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1]
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene CHRO chr01 TITL Os01g01070.1 expressed protein COOR W/28940-28976,29146-29228,29735-29806,29885-29963,30258-30331,30505-30606,31377-31466,31542-31616,31712-31744,31828-31908,32277-32330,32400-32471,32543-32617,32975-33124 HITS AAGGGGAUUGAGGAGAUUGGG [Seq] [About miRBase microRNA] [Structure] TYPE microRNA EVAL 100.00 LOCN 1000-Promotor COOR C/27938-27958 NOTE osa-miR815a MIMAT0004058 Oryza sativa miR815a osa-miR815b MIMAT0004059 Oryza sativa miR815b osa-miR815c MIMAT0004060 Oryza sativa miR815c HITS PFG_3A-09045.L [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN 1000-Promotor COOR W/28013-28700 NOTE A20594 2715 Dongjin T-DNA Left Border HITS PFG_2D-30058.R [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN 1000-Promotor COOR W/28388-28712 NOTE D06042 2772 Dongjin T-DNA Right Border HITS smRNA73350_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR C/28529-28552 HITS PFG_3A-09614.R [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN 300-UTR5 COOR W/28799-29440 NOTE A21386 2715 Dongjin T-DNA Right Border HITS J033111I18 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 99.80 LOCN Exon COOR W/28818-28976,29146-29228,29735-29806,29885-29963,30258-30325,30505-30606,31377-31466,31542-31616,31712-31744,31828-31908,32277-32330,32400-32471,32543-32617,32975-33453 HITS BT060997 [GenBank] TYPE Maize cDNA EVAL 6e-80 LOCN Exon COOR W/28937-28950,29181-29196,29756-29775,29885-29911,30259-30270,30284-30303,30502-30538,31380-31409,31492-31505,31506-31524,31542-31566,31617-31647,31828-31856,31926-31942,32274-32293,32332-32350,32540-32565,32975-33005,33054-33072,33076-33094 HITS BT066602 [GenBank] TYPE Maize cDNA EVAL 2e-76 LOCN Exon COOR W/28983-28998,29181-29196,29756-29775,29885-29911,30259-30270,30284-30303,30502-30538,31380-31409,31492-31505,31506-31524,31542-31566,31617-31647,31828-31856,31926-31942,32274-32293,32332-32350,32540-32565,32975-33005,33054-33080 HITS AGATGATGTGGCTGTTT [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Intron COOR C/29528-29544 NOTE 0 0 0 1 0 0 HITS GAGATGATGTGGCTGTT [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Intron COOR C/29529-29545 NOTE 5 0 0 0 0 0 HITS CGAGATGATGTGGCTGT [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Intron COOR C/29530-29546 NOTE 2 0 0 0 0 0 HITS GTTTTCACAGGTTTTCA [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Intron COOR C/30874-30890 NOTE 0 0 0 0 0 2 HITS PFG_1C-03852.R [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR C/31097-31634 NOTE B03027 2707 Hwayoung T-DNA Right Border HITS RMD_03Z11CT33-3 [Seq] [About RMD] [Trait] [iSect Primer] [Request] TYPE RMD T-DNA EVAL 0.0 LOCN 300-UTR3 COOR C/32740-33304 HITS RMD_ATL-03Z11CT33_LBT2 [Seq] [About RMD] [Trait] [iSect Primer] [Request] TYPE RMD T-DNA EVAL 0.0 LOCN 300-UTR3 COOR C/32740-33304 HITS PFG_3A-05546.L [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR W/32797-33364 NOTE A15657 2715 Dongjin T-DNA Left Border HITS ND2009_0_701_1A [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33369 NOTE FT907814 HITS ND2019_0_701_1A [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33369 NOTE FT907848 HITS ND2047_0_702_1A [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33369 NOTE FT907999 HITS ND2048_0_701_1A [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33369 NOTE FT908006 HITS ND2049_0_702_1A [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33369 NOTE FT908011 HITS ND2049_0_703_1A [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33369 NOTE FT908012 HITS ND2053_0_702_1A [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33599 NOTE AG023766 HITS T08420T [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33561 NOTE FT919116 HITS T08501T [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33369 NOTE FT919134 HITS T08507T [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL e-163 LOCN Exon COOR W/33050-33339 NOTE FT919137 HITS T08508T [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 3e-67 LOCN Exon COOR W/33050-33178 NOTE FT919138 HITS T08528T [Seq] [NCBI GSS] [About Rice Tos17 Insertion Mutant (RTIM)] [iSect Primer] TYPE RTIM Tos17 EVAL 0.0 LOCN Exon COOR W/33050-33561 NOTE FT919144 HITS PFG_2C-30136.R [Seq] [About PFG] [Paper] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Exon COOR W/33088-33719 NOTE C13113 2717 Dongjin T-DNA Right Border

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2010 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |