RiceGE: Genome Express Database ( Jan. 16, 2018 )


CODE Os01g01050 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr01
TITL R3H domain containing protein, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m42816 (update, updateIDs: 123099, (gene: 12001.t00005, model: 12001.m42816)); PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06752 (
COOR W/20034-20083,20374-20649,20764-20835,21294-21379,22247-22321,22685-23193

HITS J023124E16 [GenBank] [About KOME] [Order from RGRC] [Microarray] 
TYPE KOME FL-cDNA
EVAL 99.85
LOCN Exon
COOR W/19643-20083,20374-20649,20764-20835,21294-21379,22247-22321,22685-23502,23492-23694
HITS CI742783 [GenBank] 
TYPE Rice EST ctgs
EVAL 0.0
LOCN 300-UTR5
COOR W/19663-20024
NOTE CR279604 
HITS CB654231 [GenBank] 
TYPE Rice EST ctgs
EVAL e-130
LOCN Exon
COOR W/20007-20082,20416-20651,20766-20835,21294-21379,22247-22318,22682-22820
NOTE CB653778 
HITS GATCAATTTCGCCGTCCAAT [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/20036-20055 NOTE 0 0 9 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 HITS GATCAATTTCGCCGTCC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/20036-20052 NOTE 0 0 7 0 0 0 0 9 0 0 0 0 0 0 0 0 0 0 HITS CATGTATCACATCGATGTAAT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN Intron COOR W/20310-20330 HITS BT034332 [GenBank] TYPE Maize cDNA EVAL 4e-34 LOCN Exon COOR W/20417-20446,20502-20533,20548-20584,20657-20670,20723-20760,21295-21321,21377-21405,22658-22680,22681-22762,22918-22996,23074-23115,23116-23128,23208-23258 NOTE ZM_BFb0129K02 HITS BT038968 [GenBank] TYPE Maize cDNA EVAL 2e-28 LOCN Exon COOR W/20417-20481,20585-20606,20656-20678,20723-20760,21295-21322,21377-21405,22681-22761,22762-22775,22921-23000,23001-23037,23074-23113,23114-23128,23192-23236 NOTE ZM_BFb0345L04 HITS BT087356 [GenBank] TYPE Maize cDNA EVAL 8e-22 LOCN Exon COOR W/20417-20446,20502-20533,20548-20560,20585-20606,20657-20670,20723-20738,20739-20770,20835-20858,21317-21331,21389-21421,22236-22277,22360-22402,22673-22707,22777-22814 NOTE ZM_BFb0053E04 HITS RMD_03Z11GQ90 [Seq] [About RMD] [Trait] [iSect Primer] [Request] TYPE RMD T-DNA EVAL e-167 LOCN Exon COOR C/20947-21300 HITS CB680986 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/21294-21379,22247-22318,22682-23105 HITS PFG_3A-52295.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL e-108 LOCN Intron COOR C/21777-21979 NOTE A37200 2715 Dongjin T-DNA Right Border HITS RdSpm1668A_3.1 [Seq] [About UCD Rice FST] [GenBank] [iSect Primer] [Order Lines] TYPE UCD dSpm EVAL 0.0 LOCN Exon COOR C/22239-23105 HITS RMD_04Z11GO30-2 [Seq] [About RMD] [Trait] [iSect Primer] [Request] TYPE RMD T-DNA EVAL e-162 LOCN Exon COOR C/22630-23006 HITS GATCGCGCATGCACTTGGCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/22851-22870 NOTE 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 HITS GATCGCGCATGCACTTG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/22851-22867 NOTE 5 0 0 0 0 3 0 0 0 0 0 0 0 0 0 2 23 0 HITS CB653779 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR C/22908-23491,23503-23696 NOTE CB680987 CI360805 CI525035 HITS Os-27637-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 100.00 LOCN Exon COOR W/23120-23663 HITS CATGCCCTGCGGCTGCCTGGT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN Exon COOR W/23134-23154 HITS CI028440 [GenBank] TYPE Rice EST ctgs EVAL e-148 LOCN 300-UTR3 COOR W/23363-23491,23503-23773 NOTE CI295822 CODE Os01g01050 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene CHRO chr01 TITL R3H domain containing protein, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m42816 (update, updateIDs: 123099, (gene: 12001.t00005, model: 12001.m42816)); PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12001.m06752 ( COOR W/20060-20083,20417-20649,20764-20835,21294-21379,22247-22321,22685-23193 HITS J023124E16 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 99.85 LOCN Exon COOR W/19643-20083,20374-20649,20764-20835,21294-21379,22247-22321,22685-23502,23492-23694 HITS CI742783 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN 300-UTR5 COOR W/19663-20024 NOTE CR279604 HITS CB654231 [GenBank] TYPE Rice EST ctgs EVAL e-130 LOCN Exon COOR W/20007-20082,20416-20651,20766-20835,21294-21379,22247-22318,22682-22820 NOTE CB653778 HITS GATCAATTTCGCCGTCCAAT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN 300-UTR5 COOR W/20036-20055 NOTE 0 0 9 0 0 0 0 10 0 0 0 0 0 0 0 0 0 0 HITS GATCAATTTCGCCGTCC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN 300-UTR5 COOR W/20036-20052 NOTE 0 0 7 0 0 0 0 9 0 0 0 0 0 0 0 0 0 0 HITS CATGTATCACATCGATGTAAT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN Intron COOR W/20310-20330 HITS BT034332 [GenBank] TYPE Maize cDNA EVAL 4e-34 LOCN Exon COOR W/20417-20446,20502-20533,20548-20584,20657-20670,20723-20760,21295-21321,21377-21405,22658-22680,22681-22762,22918-22996,23074-23115,23116-23128,23208-23258 NOTE ZM_BFb0129K02 HITS BT038968 [GenBank] TYPE Maize cDNA EVAL 2e-28 LOCN Exon COOR W/20417-20481,20585-20606,20656-20678,20723-20760,21295-21322,21377-21405,22681-22761,22762-22775,22921-23000,23001-23037,23074-23113,23114-23128,23192-23236 NOTE ZM_BFb0345L04 HITS BT087356 [GenBank] TYPE Maize cDNA EVAL 8e-22 LOCN Exon COOR W/20417-20446,20502-20533,20548-20560,20585-20606,20657-20670,20723-20738,20739-20770,20835-20858,21317-21331,21389-21421,22236-22277,22360-22402,22673-22707,22777-22814 NOTE ZM_BFb0053E04 HITS RMD_03Z11GQ90 [Seq] [About RMD] [Trait] [iSect Primer] [Request] TYPE RMD T-DNA EVAL e-167 LOCN Exon COOR C/20947-21300 HITS CB680986 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR W/21294-21379,22247-22318,22682-23105 HITS PFG_3A-52295.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL e-108 LOCN Intron COOR C/21777-21979 NOTE A37200 2715 Dongjin T-DNA Right Border HITS RdSpm1668A_3.1 [Seq] [About UCD Rice FST] [GenBank] [iSect Primer] [Order Lines] TYPE UCD dSpm EVAL 0.0 LOCN Exon COOR C/22239-23105 HITS RMD_04Z11GO30-2 [Seq] [About RMD] [Trait] [iSect Primer] [Request] TYPE RMD T-DNA EVAL e-162 LOCN Exon COOR C/22630-23006 HITS GATCGCGCATGCACTTGGCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/22851-22870 NOTE 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 HITS GATCGCGCATGCACTTG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/22851-22867 NOTE 5 0 0 0 0 3 0 0 0 0 0 0 0 0 0 2 23 0 HITS CB653779 [GenBank] TYPE Rice EST ctgs EVAL 0.0 LOCN Exon COOR C/22908-23491,23503-23696 NOTE CB680987 CI360805 CI525035 HITS Os-27637-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 100.00 LOCN Exon COOR W/23120-23663 HITS CATGCCCTGCGGCTGCCTGGT [About LongSAGE] [SAGE Libraries] [Tag Expression] TYPE LongSAGE Tags EVAL 100.00 LOCN Exon COOR W/23134-23154 HITS CI028440 [GenBank] TYPE Rice EST ctgs EVAL e-148 LOCN 300-UTR3 COOR W/23363-23491,23503-23773 NOTE CI295822

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2018 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |