CODE Os09g01000 [Seq] [RiceGE6]  [RiceGE6 Text] [RiceGE v5] [About MSU Rice Annotation v 6.1] 
[Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene CHRO chr09 TITL Os09g01000.1 expressed protein COOR W/14829-15125 HITS 001-202-E11 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 99.95 LOCN Exon COOR W/13043-14879 HITS 002-159-G04 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 64.19 LOCN Exon COOR W/13103-15097 HITS 002-166-F10 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 17.36 LOCN Exon COOR W/13179-13268,14811-15137 HITS 001-125-F03 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 44.54 LOCN Exon COOR W/13318-13394,29158-29232 HITS 001-114-E06 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 65.60 LOCN 1000-Promotor COOR W/13321-14324 HITS 002-153-G12 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 17.01 LOCN Exon COOR W/13330-13354,19245-19427 HITS 002-159-F08 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 33.76 LOCN 1000-Promotor COOR W/13374-14411 HITS 002-159-G06 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 66.40 LOCN Exon COOR W/13505-15430 HITS M0096302_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 2.0e-171 LOCN 1000-Promotor COOR C/13568-13882 HITS M0108937_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 0.0e+00 LOCN 1000-Promotor COOR C/13569-14145 HITS M0108938_2 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 0.0e+00 LOCN 1000-Promotor COOR C/13569-14145 HITS 001-030-B07 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 100.00 LOCN 300-UTR5 COOR W/13660-14677 HITS 001-206-D04 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 50.65 LOCN 1000-Promotor COOR W/13717-14413 HITS 002-159-C05 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 19.67 LOCN 1000-Promotor COOR W/13717-14357 HITS 002-178-F11 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 28.81 LOCN 1000-Promotor COOR W/13717-13991,13992-14418 HITS 002-176-H02 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 66.02 LOCN Exon COOR W/13719-15755 HITS 002-179-G12 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 70.06 LOCN Exon COOR W/13719-15453 HITS 002-176-F12 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 40.87 LOCN Exon COOR W/13723-14874 HITS 002-165-H07 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 51.88 LOCN Exon COOR W/13725-15206 HITS 002-164-C07 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 62.46 LOCN Exon COOR W/13737-15260 HITS M0079252_2 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 2.5e-83 LOCN 1000-Promotor COOR C/13744-13904 HITS M0104270_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 2.7e-190 LOCN 1000-Promotor COOR C/13744-14093 HITS M0107798_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 0.0e+00 LOCN 1000-Promotor COOR C/13744-14390 HITS 001-123-F01 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 63.77 LOCN Exon COOR W/13772-15457 HITS M0098398_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 7.1e-207 LOCN 1000-Promotor COOR C/13775-14151 HITS M0109353_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 3.5e-70 LOCN 1000-Promotor COOR C/13775-13912 HITS M0079252_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 3.6e-58 LOCN 1000-Promotor COOR C/13788-13904 HITS M0004577_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 5.2e-200 LOCN 1000-Promotor COOR C/13828-14194 HITS 001-116-H11 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 77.45 LOCN Exon COOR W/13834-15200 HITS 002-162-A01 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 38.45 LOCN Exon COOR W/13838-15204 HITS 002-177-A02 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 78.67 LOCN Exon COOR W/13838-15816,35259-35467 HITS 002-164-F03 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 60.07 LOCN Exon COOR W/13853-15588 HITS M0109606_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 9.8e-210 LOCN 1000-Promotor COOR C/13903-14286 HITS 002-166-A07 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 32.01 LOCN Exon COOR W/13958-14959 HITS M0013955_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.5e-176 LOCN 1000-Promotor COOR W/13971-14294 HITS M0109606_2 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 5.6e-164 LOCN 1000-Promotor COOR C/13985-14286 HITS smRNA112213_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/13991-14011 HITS smRNA81613_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/13999-14020 HITS 001-113-B06 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 73.94 LOCN Exon COOR W/14006-15293 HITS 002-119-A08 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 76.34 LOCN Exon COOR W/14006-15156,32086-32193 HITS 002-164-H10 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 32.96 LOCN Exon COOR W/14006-14836 HITS smRNA134040_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14008-14027 HITS smRNA132953_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14009-14030 HITS smRNA18288_3x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14010-14030 HITS smRNA25021_5x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14010-14029 HITS smRNA22696_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14012-14030 HITS smRNA4027_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14012-14029 HITS M0078565_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 2.0e-20 LOCN 1000-Promotor COOR W/14032-14082 HITS M0058357_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 2.3e-111 LOCN 1000-Promotor COOR C/14049-14258 HITS 001-015-B11 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 100.00 LOCN Exon COOR W/14052-15258 HITS 002-153-F06 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 40.33 LOCN 1000-Promotor COOR W/14072-14415 HITS 002-165-C09 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 51.09 LOCN Exon COOR W/14075-15453 HITS 002-160-F02 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 50.31 LOCN Exon COOR W/14085-15030,30885-31501 HITS 002-166-F02 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 42.34 LOCN Exon COOR W/14102-15292 HITS 002-103-C05 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 61.19 LOCN Exon COOR W/14103-15204 HITS 002-159-C04 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 23.79 LOCN Exon COOR W/14105-14929 HITS M0087459_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 5.0e-65 LOCN 1000-Promotor COOR W/14225-14353,14357-14455 HITS M0126043_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.4e-33 LOCN 1000-Promotor COOR W/14227-14300 HITS smRNA117218_2x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14248-14267 HITS smRNA19714_3x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14248-14269 HITS smRNA19714_6x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14248-14269 HITS smRNA23218_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14248-14266 HITS smRNA2942_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14248-14270 HITS smRNA32135_3x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14248-14271 HITS smRNA52252_4x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14248-14268 HITS smRNA131435_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14249-14268 HITS smRNA15445_7x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14249-14271 HITS smRNA19202_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14249-14270 HITS smRNA19202_2x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14249-14270 HITS smRNA42868_4x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14249-14269 HITS smRNA82846_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14250-14271 HITS smRNA3283_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14251-14269 HITS smRNA3283_2x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14251-14269 HITS smRNA6056_2x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14251-14270 HITS smRNA6998_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14251-14271 HITS smRNA18872_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14252-14269 HITS smRNA19981_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14252-14270 HITS smRNA19817_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14253-14271 HITS 002-152-C06 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 38.60 LOCN Exon COOR W/14296-15137 HITS 002-166-D01 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 41.26 LOCN Exon COOR W/14315-15265 HITS 002-168-F02 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 9.75 LOCN 1000-Promotor COOR W/14318-14435 HITS 001-100-B01 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 67.44 LOCN Exon COOR W/14322-16124 HITS smRNA99499_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14327-14352 HITS 002-165-G09 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 44.48 LOCN Exon COOR W/14330-15941 HITS CGGCGGCCGCCGCAAAA [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN 1000-Promotor COOR W/14332-14348 NOTE 0 0 2 0 0 0 HITS GGCGGCCGCCGCAAAAC [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN 1000-Promotor COOR W/14333-14349 NOTE 0 0 1 0 0 0 HITS CGGCCGCCGCAAAACCC [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN 1000-Promotor COOR W/14335-14351 NOTE 0 0 5 0 0 0 HITS GGCCGCCGCAAAACCCG [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN 1000-Promotor COOR W/14336-14352 NOTE 0 1 0 0 0 0 HITS M0059418_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 5.3e-29 LOCN 1000-Promotor COOR W/14341-14406 HITS smRNA51964_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14358-14381 HITS smRNA55540_2x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14358-14382 HITS smRNA58532_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14359-14381 HITS smRNA23858_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14362-14383 HITS smRNA24197_5x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14362-14382 HITS M0115323_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.1e-149 LOCN 300-UTR5 COOR C/14371-14647 HITS M0117539_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 2.5e-83 LOCN 300-UTR5 COOR C/14371-14531 HITS M0078392_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.9e-56 LOCN 1000-Promotor COOR C/14379-14492 HITS 002-178-G09 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 63.51 LOCN Exon COOR W/14401-15924 HITS 002-163-H01 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 53.28 LOCN Exon COOR W/14409-15902 HITS 002-159-E01 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 57.60 LOCN Exon COOR W/14416-15453 HITS 002-179-C03 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 53.66 LOCN Exon COOR W/14416-15389 HITS 002-119-H12 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 56.46 LOCN Exon COOR W/14424-15293 HITS smRNA13130_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 1000-Promotor COOR W/14428-14446 HITS M0015170_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 6.2e-116 LOCN 300-UTR5 COOR C/14433-14650 HITS M0079170_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.4e-33 LOCN 1000-Promotor COOR C/14440-14513 HITS M0090492_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 3.6e-58 LOCN 300-UTR5 COOR C/14440-14556 HITS M0079342_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 3.3e-106 LOCN 300-UTR5 COOR C/14442-14642 HITS M0067729_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 2.8e-23 LOCN 1000-Promotor COOR W/14446-14501 HITS M0077980_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.4e-33 LOCN 1000-Promotor COOR W/14467-14540 HITS M0108723_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.4e-200 LOCN 1000-Promotor COOR W/14477-14844 HITS M0039770_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 4.7e-93 LOCN 300-UTR5 COOR C/14524-14703 HITS M0093952_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 7.7e-167 LOCN 300-UTR5 COOR W/14538-14844 HITS M0079342_2 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 5.1e-49 LOCN 300-UTR5 COOR C/14539-14642 HITS smRNA5390_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN 300-UTR5 COOR W/14605-14625 HITS M0102435_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 5.2e-200 LOCN Exon COOR C/14612-14976 HITS M0081101_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.9e-56 LOCN 300-UTR5 COOR C/14615-14728 HITS M0088659_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.9e-56 LOCN 300-UTR5 COOR C/14615-14728 HITS M0080974_2 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 7.0e-56 LOCN 300-UTR5 COOR C/14616-14728 HITS M0077001_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 4.7e-93 LOCN 300-UTR5 COOR C/14643-14822 HITS M0087662_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 5.5e-172 LOCN Exon COOR C/14658-14975 HITS M0080974_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.0e-30 LOCN 300-UTR5 COOR C/14660-14728 HITS M0017596_2 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 5.0e-57 LOCN Exon COOR C/14774-14888 HITS 002-179-D07 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 36.11 LOCN Exon COOR W/14788-15814 HITS M0032685_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 3.2e-118 LOCN 300-UTR5 COOR W/14800-15023 HITS 001-005-E07 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 83.48 LOCN Exon COOR W/14841-16152 HITS smRNA13794_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN Exon COOR W/14959-14976 HITS CCGCGTGCCGGCCGGGG [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Exon COOR W/14979-14995 NOTE 0 0 15 0 0 0 HITS smRNA117081_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN Exon COOR W/14979-14996 HITS smRNA21952_2x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN Exon COOR W/14979-14998 HITS smRNA43408_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN Exon COOR W/14979-15001 HITS CGCGTGCCGGCCGGGGG [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Exon COOR W/14980-14996 NOTE 1 1 0 1 0 0 HITS GCGTGCCGGCCGGGGGA [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Exon COOR W/14981-14997 NOTE 0 0 3 0 0 0 HITS smRNA7855_1x [Seq] [About CSRDB smallRNA] TYPE smRNA CSRDB EVAL 100.00 LOCN Exon COOR W/14981-14998 HITS CGTGCCGGCCGGGGGAC [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Exon COOR W/14982-14998 NOTE 0 0 3 12 1 3 HITS GTGCCGGCCGGGGGACG [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Exon COOR W/14983-14999 NOTE 0 19 4 0 2 1 HITS GCCGGCCGGGGGACGGA [Seq] [About MPSS smallRNA]
Note : STM SNU FLR SNM ABA UNT TYPE smRNA MPSS EVAL 100.00 LOCN Exon COOR W/14985-15001 NOTE 0 27 23 45 126 164 HITS 002-131-B09 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 37.12 LOCN Exon COOR W/15083-15589 HITS 001-008-B11 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 60.22 LOCN Exon COOR W/15087-15846 HITS 006-204-A03 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 99.00 LOCN Exon COOR W/15087-15978 HITS 001-031-A06 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 59.02 LOCN Exon COOR W/15100-15825 HITS 002-178-G02 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 34.60 LOCN 300-UTR3 COOR W/15138-16091 HITS M0108570_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 7.3e-191 LOCN 300-UTR3 COOR W/15175-15523 HITS M0026998_2 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 5.2e-45 LOCN 300-UTR3 COOR W/15200-15293 HITS 002-159-H06 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 15.73 LOCN 300-UTR3 COOR W/15237-15863 HITS 001-022-E01 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 52.46 LOCN 300-UTR3 COOR W/15245-15404 HITS M0113744_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 7.8e-163 LOCN 300-UTR3 COOR W/15254-15553 HITS M0113744_2 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 8.1e-143 LOCN 300-UTR3 COOR W/15254-15518 HITS M0105294_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.6e-144 LOCN 300-UTR3 COOR W/15256-15523 HITS M0023919_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.5e-17 LOCN 300-UTR3 COOR C/15293-15338 HITS 002-102-B01 [GenBank] [About KOME] [Order from RGRC] [Microarray] TYPE KOME FL-cDNA EVAL 58.17 LOCN 300-UTR3 COOR W/15307-16100 HITS AAGGGAACGGGCUUGGCGGAAU [Seq] [About miRBase microRNA] [Structure] TYPE microRNA EVAL 100.00 LOCN 300-UTR3 COOR W/15314-15335 NOTE mmu-miR-2138 MIMAT0011214 Mus musculus miR-2138 HITS M0027386_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 8.2e-135 LOCN 300-UTR3 COOR W/15327-15577 HITS M0027386_2 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 8.2e-135 LOCN 300-UTR3 COOR W/15327-15577 HITS M0027514_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 8.2e-135 LOCN 300-UTR3 COOR W/15327-15577 HITS M0027514_2 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.7e-116 LOCN 300-UTR3 COOR W/15359-15577 HITS M0060552_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 4.5e-105 LOCN 300-UTR3 COOR W/15379-15577 HITS M0037875_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.2e-97 LOCN 300-UTR3 COOR W/15392-15577 HITS M0037875_2 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 6.4e-100 LOCN 300-UTR3 COOR W/15392-15583 HITS M0101042_1 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1.8e-84 LOCN 300-UTR3 COOR W/15406-15568