RiceGE: Genome Express Database ( Oct. 6, 2010 )


CLON CATGGAATTGCTAAATAACTT[About LongSAGE] [SAGE Libraries] [Tag Expression] 
TYPE LongSAGE Tags
CHRO chr10
EVAL 100.00
COOR C/21638955-21638975

HITS Os10g40880[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
TITL flavonol synthase/flavanone 3-hydroxylase, putative, expressed
LOCN 300-UTR3
COOR C/21639238-21639483,21639626-21639950,21640148-21640395,21640581-21640814



hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2010 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |