RiceGE: Genome Express Database ( Oct. 6, 2010 )


CLON CATGATTCAACCTTTTCTTCT[About LongSAGE] [SAGE Libraries] [Tag Expression] 
TYPE LongSAGE Tags
CHRO chr10
EVAL 100.00
COOR C/21661394-21661414

HITS Os10g40934[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
TITL flavonol synthase/flavanone 3-hydroxylase, putative, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12010.m50436 (update, updateIDs: 52410, (gene: 12010.t03332, model: 12010.m50436)); PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12010.m50383 (u
LOCN Intron
COOR C/21659178-21659423,21662437-21662775



hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2010 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |