RiceGE: Genome Express Database ( Oct. 6, 2010 )


CLON GATCGACGCATGTGCTGTCA[About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 CHRO chr10 EVAL 1 COOR W/21628907-21628926 NOTE 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2010 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |