RiceGE: Genome Express Database ( Oct. 6, 2010 )


CLON GATCCTTTTGCGAAATTCTC[About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 CHRO chr10 EVAL 1 COOR W/21615316-21615335 NOTE 189 0 0 0 0 27 25 0 174 43 112 0 28 0 57 0 0 0 HITS Os10g40810[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL GATA transcription factor 9, putative, expressed PASA (rice_osa1r5_gmapsim4_05232006) AUTOUPDATE: Updated structure of 12010.m06851 (update, updateIDs: 52401, (gene: 12010.t03323, model: 12010.m06851)); (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12010.m06851.) ; LOCN 300-UTR3 COOR W/21613869-21614282,21614464-21615213

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2010 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |