RiceGE: Genome Express Database ( Oct. 6, 2010 )


CLON GATCATCTGCTCACTGACAT[About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 CHRO chr10 EVAL 1 COOR C/21622396-21622415 NOTE 0 0 0 0 0 5 0 13 0 0 0 0 0 0 0 0 0 0 HITS Os10g40820[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL expressed protein (PASA (rice_release4_08302005) AUTOUPDATE: Updated structure of 12010.m06852.) ; LOCN Intron COOR C/21620006-21620142,21620889-21620952,21621626-21621654,21622655-21622868

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2010 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |