RiceGE: Genome Express Database ( Oct. 6, 2010 )

Query : MPSS GATCATCTGCTCACTGACAT not found or hidden.

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2010 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |