RiceGE: Genome Express Database ( Oct. 6, 2010 )

CLON GATCACCAATAGCCCAAGAG[About MPSS Rice] [Paper] [Signature Analysis] 
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 CHRO chr10 EVAL 1 COOR W/21698570-21698589 NOTE 0 0 0 0 0 0 8 0 0 0 0 0 0 0 0 0 0 0 HITS Os10g41030[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL ATG2484-1, putative, expressed (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12010.t03340 = 12010.m21968); (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12010.t03340 = 12010.m21967); (PASA (rice_release4_08302005) AUTOUP LOCN Exon COOR C/21694874-21694890,21694981-21695071,21696416-21697270,21697372-21697481,21697897-21697964,21698545-21698725,21698974-21699076,21699163-21699269,21699936-21701474,21701551-21701661,21701746-21701798,21701878-21701953,21702037-21702256,21702367-21702791,21703083-21703262,21703393-21705364 HITS Os10g41030[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL ATG2484-1, putative, expressed (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12010.t03340 = 12010.m21968); (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12010.t03340 = 12010.m21967); (PASA (rice_release4_08302005) AUTOUP LOCN Exon COOR C/21694874-21694890,21694981-21695071,21696416-21697270,21697372-21697484,21697897-21697964,21698545-21698725,21698974-21699076,21699163-21699269,21699936-21701474,21701551-21701661,21701746-21701798,21701878-21701953,21702037-21702256,21702367-21702791,21703083-21703262,21703393-21705364 HITS Os10g41030[Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] TYPE Gene TITL ATG2484-1, putative, expressed (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12010.t03340 = 12010.m21968); (PASA (rice_release4_08302005) ALT-SPLICE: Added alt splice isoform to 12010.t03340 = 12010.m21967); (PASA (rice_release4_08302005) AUTOUP LOCN Exon COOR C/21697880-21697964,21698545-21698725,21698974-21699076,21699163-21699269,21699936-21701474,21701551-21701661,21701746-21701798,21701878-21701953,21702037-21702256,21702367-21702791,21703083-21703262,21703393-21705364

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2010 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |