RiceGE: Genome Express Database ( Oct. 6, 2010 )


CODE Os10g40859 [Seq] [RiceGE] [RiceGE Text] [Rice GO] [Gramene] [SNP] [Microarray: RMOS|GEO] [TIGR Evidence] 
TYPE Gene
CHRO chr10
TITL matrixin family protein
COOR C/21632714-21633575,21634294-21634488,21634679-21634749,21635783-21636584,21637177-21637213,21637760-21638513

HITS CATCTGAGAAATTGGCT [About MPSS Rice] [Paper] [Signature Analysis] 
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN 300-UTR3 COOR W/21632399-21632415 NOTE 0 0 0 0 5 0 HITS PFG_3A-13419.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Exon COOR C/21632526-21632912 NOTE A26885 2715 Dongjin T-DNA Right Border HITS OsAffx-20140-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 100.00 LOCN Exon COOR C/21632750-21633188 HITS At1g70170 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL 5e-31 LOCN Exon COOR W/21632944-21632963,21633151-21633173,21636367-21636402,21636469-21636491,21637819-21637867,21638000-21638060,21638135-21638171 HITS At4g16640 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL 6e-46 LOCN Exon COOR W/21632960-21632988,21633101-21633121,21633151-21633172,21636152-21636166,21636421-21636474,21636469-21636480,21637825-21637885,21637860-21637894,21638009-21638069,21638022-21638037,21638138-21638176,21638196-21638234 HITS At2g45040 [T-DNA Express] [Transcriptome] [T-DNA Express Text] TYPE Arabidopsis CDS EVAL 4e-48 LOCN Exon COOR W/21633067-21633078,21636191-21636237,21636273-21636289,21636421-21636474,21636469-21636480,21637819-21637903,21637911-21637985,21638135-21638240,21638197-21638223,21638216-21638229 HITS GATCGTTGTCACGTAACTAG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Exon COOR W/21633560-21633579 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 HITS GATCGTTGTCACGTAAC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Exon COOR W/21633560-21633576 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 HITS GATCCGATGTTGTCACTTCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Intron COOR C/21634128-21634147 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 HITS GATCCGATGTTGTCACT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 1 LOCN Intron COOR C/21634131-21634147 NOTE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 HITS GTTTCTGCACCATCGCA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR C/21634568-21634584 NOTE 0 0 0 1 0 0 HITS M0050974 [Seq] [About TRIM FST] [GenBank] [iSect Primer] [Order or Feedback] TYPE TRIM T-DNA EVAL 1e-14 LOCN Intron COOR W/21634864-21634905 HITS GTTTGATCTACTTGGTG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR W/21635598-21635614 NOTE 3 0 0 0 0 0 HITS OsAffx-30740-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 100.00 LOCN Exon COOR C/21635775-21636328 HITS PFG_4A-00632.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR C/21636924-21637449,21637539-21637604 NOTE A40578 2715 Dongjin T-DNA Left Border HITS PFG_3A-50149.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR C/21636932-21637431 NOTE A34211 2715 Dongjin T-DNA Left Border HITS PFG_4A-00632.L [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL 0.0 LOCN Intron COOR C/21637006-21637614 NOTE A40578 2715 Dongjin T-DNA Left Border HITS CGGATGTTTCATCGGAT [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Intron COOR C/21637331-21637347 NOTE 0 0 0 0 0 1 HITS DAG3B04 [Seq] [GenBank] [About Genoplante Rice Tag Line] [iSect Primer] TYPE Genoplante T-DNA EVAL 5e-90 LOCN Intron COOR C/21637465-21637582,21637592-21637759 HITS SAH3G12 [Seq] [GenBank] [About Genoplante Rice Tag Line] [iSect Primer] TYPE Genoplante T-DNA EVAL 2e-88 LOCN Intron COOR C/21637465-21637582,21637592-21637756 HITS GATCTGCAGTATGGTGAGAG [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 20 EVAL 1 LOCN Intron COOR C/21637691-21637710 NOTE 0 0 0 0 0 0 0 0 0 13 0 0 0 0 0 0 0 0 HITS GATCTGCAGTATGGTGA [About MPSS Rice] [Paper] [Signature Analysis]
NOTE NYR NR2 NYL NL4 NGD NST NME NPO NSO NIP NGS NCA NSR NSL NDR NDL NCR NCL TYPE MPSS mRNA 17 EVAL 2 LOCN Intron COOR C/21637694-21637710 NOTE 0 0 0 0 0 0 0 0 0 11 0 0 0 0 0 0 0 0 HITS PFG_4A-00632.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL e-117 LOCN Intron COOR W/21637705-21637927 NOTE A40580 2715 Dongjin T-DNA Right Border HITS PFG_3A-50149.R [Seq] [About PFG] [Vector] [iSect Primer] [Order/Request] [RAP-DB] TYPE PFG T-DNA EVAL e-119 LOCN Intron COOR W/21637709-21637926 NOTE A34212 2715 Dongjin T-DNA Right Border HITS OsAffx-20138-1-S1_at [About Rice GeneChip] [Gene Expression Atlas] [GEO GPL2025] TYPE Affy GeneChip EVAL 100.00 LOCN Exon COOR C/21637776-21638221 HITS GAGGCCGAGGGCGTGGC [About MPSS Rice] [Paper] [Signature Analysis]
NOTE : STM SNU FLR SNM ABA UNT (unit: TPQ = transcripts per quarter million) TYPE MPSS SmallRNA EVAL 100.00 LOCN Exon COOR W/21637944-21637960 NOTE 0 0 10 0 0 0 HITS RdSpm1969B_3.1 [Seq] [About UCD Rice FST] [GenBank] [iSect Primer] [Order Lines] TYPE UCD dSpm EVAL e-171 LOCN Exon COOR W/21638382-21638756 HITS RdSpm1973_3.1 [Seq] [About UCD Rice FST] [GenBank] [iSect Primer] [Order Lines] TYPE UCD dSpm EVAL e-173 LOCN Exon COOR W/21638413-21638747 HITS RdSpm1970_3.1 [Seq] [About UCD Rice FST] [GenBank] [iSect Primer] [Order Lines] TYPE UCD dSpm EVAL e-154 LOCN Exon COOR W/21638464-21638747

hits since Aug 25, 2007 | T-DNA Express | Transcriptome | RiceGE japonica | RiceGE indica | Methylome | YeastGE |
© SIGnAL 2000-2010 | Home | About Us | Microarray | FL-cDNA | SALK T-DNA | Contact Us |