CODE At1g01183 [T-DNA Express] 
TYPE Gene
CHRO chr1
TITL  gene_syn MIR165, MIR165a  gene MIR165/MIR165a  function Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: TCGGACCAGGCTTCATCCCCC  product MIR165/MIR165a; miRNA  go_component cellular_component|GO:0005575||ND  go_process miRNA-mediated gene silencing|GO:0035195|15200956|TAS  go_function molecular_function|GO:0003674||ND 
COOR C/78932-79032